콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU024471

Sigma-Aldrich

MISSION® esiRNA

targeting human FADD

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GGCTCGTCAGCTCAAAGTCTCAGACACCAAGATCGACAGCATCGAGGACAGATACCCCCGCAACCTGACAGAGCGTGTGCGGGAGTCACTGAGAATCTGGAAGAACACAGAGAAGGAGAACGCAACAGTGGCCCACCTGGTGGGGGCTCTCAGGTCCTGCCAGATGAACCTGGTGGCTGACCTGGTACAAGAGGTTCAGCAGGCCCGTGACCTCCAGAACAGGAGTGGGGCCATGTCCCCGATGTCATGGAACTCAGACGCATCTACCTCCGAAGCGTCCTGATGGGCCGCTGCTTTGCGCTGGTGGACCACAGGCATCTACACAGCCTGGACTTTGGTTCTCTCCAGGAAGGTAGCCCAGCACTGTGAAGACCCAGCAGGAAGCCAGGCTGAGTGAGCCACAGACCACCTGCTTCTGA

Ensembl | 인체 수납 번호

ENSG00000168040

NCBI 수납 번호

NM_003824

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... FADD(8772) , FADD(8772)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
ICV
LBV
WNS

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Shih-Wei Wang et al.
Molecular carcinogenesis, 57(7), 866-877 (2018-03-23)
Luteolin (3',4',5,7-tetrahydroxyflavone), which exists in fruits, vegetables, and medicinal herbs, is used in Chinese traditional medicine for treating various diseases, such as hypertension, inflammatory disorders, and cancer. However, the gene-regulatory role of luteolin in cancer prevention and therapy has not
Christiana G Savva et al.
BMC cancer, 16, 279-279 (2016-04-22)
Acquired resistance towards apoptosis is a hallmark of cancer. Elimination of cells bearing activated oncogenes or stimulation of tumor suppressor mediators may provide a selection pressure to overcome resistance. KC-53 is a novel biyouyanagin analogue known to elicit strong anti-inflammatory
Shan-Zhong Yang et al.
Laboratory investigation; a journal of technical methods and pathology, 100(5), 777-785 (2020-01-04)
TRAIL-activating therapy is promising in treating various cancers, including pancreatic cancer, a highly malignant neoplasm with poor prognosis. However, many pancreatic cancer cells are resistant to TRAIL-induced apoptosis despite their expression of intact death receptors (DRs). Protein O-GlcNAcylation is a
Zongliang Lu et al.
International journal of oncology, 56(2), 439-447 (2020-01-03)
Ophiopogonin D' (OPD') is a natural compound extracted from Ophiopogon japonicus, which is a plant used in traditional Chinese medicine. Our previous study has indicated that OPD' exhibits antitumor activity against androgen‑independent prostate cancer (PCa), but the effects and the
Fangfang Cai et al.
Cell death & disease, 11(1), 33-33 (2020-01-18)
Hydrogen sulfide (H2S) is now widely considered the third endogenous gasotransmitter and plays critical roles in cancer biological processes. In this study, we demonstrate that 5-(4-hydroxyphenyl)-3H-1,2-dithiole-3-thione (ADT-OH), the most widely used moiety for synthesising slow-releasing H2S donors, induces melanoma cell
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.