콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU024211

Sigma-Aldrich

MISSION® esiRNA

targeting human XDH

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

ATTTCCGCTGATGATGTTCCTGGGAGTAACATAACTGGAATTTGTAATGATGAGACAGTCTTTGCGAAGGATAAGGTTACTTGTGTTGGGCATATCATTGGTGCTGTGGTTGCTGACACCCCGGAACACACACAGAGAGCTGCCCAAGGGGTGAAAATCACCTATGAAGAACTACCAGCCATTATCACAATTGAGGATGCTATAAAGAACAACTCCTTTTATGGACCTGAGCTGAAGATCGAGAAAGGGGACCTAAAGAAGGGGTTTTCCGAAGCAGATAATGTTGTGTCAGGGGAGATATACATCGGTGGCCAAGAGCACTTCTACCTGGAGACTCACTGCACCATTGCTGTTCCAAAAGGCGAGGCAGGGGAGATGGAGCTCTTTGTGTCTACACAGAACACCATGAAGACCCAGAGC

Ensembl | 인체 수납 번호

ENSG00000158125

NCBI 수납 번호

NM_000379

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... XDH(7498) , XDH(7498)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

G-L Chen et al.
Oncogenesis, 6(9), e382-e382 (2017-09-26)
Xanthine dehydrogenase (XDH), a rate-limiting enzyme involved in purine metabolism, has an essential role in inflammatory cascades. Researchers have known for decades that XDH activity is decreased in some cancers, including hepatocellular carcinoma (HCC). However, the role of XDH in
You-Jin Kim et al.
International journal of molecular sciences, 21(20) (2020-10-15)
In the present study, we investigated the effects of xanthine oxidase (XO) inhibition on cholesterol-induced renal dysfunction in chronic kidney disease (CKD) mice, and in low-density lipoprotein (LDL)-treated human kidney proximal tubule epithelial (HK-2) cells. ApoE knockout (KO) mice underwent
Se-Hyun Oh et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(6), 7301-7314 (2019-03-13)
Hypercholesterolemia is reported to increase reactive oxygen species (ROS) and to promote breast cancer progression. ROS play an important role in tumor biology, and xanthine oxidase (XO) is an enzyme that generates ROS. The effects of febuxostat (FBX), an XO
Seon Min Woo et al.
Oncotarget, 8(63), 106672-106684 (2018-01-02)
Cathepsin G is a serine protease secreted from activated neutrophils, it has important roles in inflammation and immune response. Moreover, cathepsin G promotes tumor cell-cell adhesion and migration in cancer cells. In this study, we investigated whether inhibition of cathepsin
Haixia Xu et al.
Free radical biology & medicine, 139, 70-79 (2019-05-20)
The natural compound Alternol was shown to induce profound oxidative stress and apoptotic cell death preferentially in cancer cells. In this study, a comprehensive investigation was conducted to understand the mechanism for Alternol-induced ROS accumulation responsible for apoptotic cell death.

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.