콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU023751

Sigma-Aldrich

MISSION® esiRNA

targeting human IL1B

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CAGCCAATCTTCATTGCTCAAGTGTCTGAAGCAGCCATGGCAGAAGTACCTGAGCTCGCCAGTGAAATGATGGCTTATTACAGTGGCAATGAGGATGACTTGTTCTTTGAAGCTGATGGCCCTAAACAGATGAAGTGCTCCTTCCAGGACCTGGACCTCTGCCCTCTGGATGGCGGCATCCAGCTACGAATCTCCGACCACCACTACAGCAAGGGCTTCAGGCAGGCCGCGTCAGTTGTTGTGGCCATGGACAAGCTGAGGAAGATGCTGGTTCCCTGCCCACAGACCTTCCAGGAGAATGACCTGAGCACCTTCTTTCCCTTCATCTTTGAAGAAGAACCTATCTTCTTCGACACATGGGATAACGAGGCTTATGTGCACGATGCACCTGTACGATCACTGAACTGCACGCTCCGGGACTCACAGCAAAAAAGCTTGGTGATGTCTGGTCCATATGAACTGAAAGCTCTCCACCTCCAGGGACAGGATATGGA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Dong-Dong Zhu et al.
Cardiovascular diabetology, 15, 42-42 (2016-03-06)
Previous studies have shown that high glucose (HG) induced endothelial cell (EC) damage via a phenotypic transition of EC. There is increasing evidence suggesting the role of inflammatory cytokines in mediated HG-induced EC damage. However, little is known about the
Dhivya Thiyagarajan et al.
PloS one, 10(6), e0129485-e0129485 (2015-06-13)
We have demonstrated that the renal endonuclease DNaseI is up-regulated in mesangial nephritis while down-regulated during progression of the disease. To determine the basis for these reciprocal DNaseI expression profiles we analyse processes accounting for an early increase in renal
Ravi S Keshari et al.
PloS one, 7(10), e48111-e48111 (2012-10-31)
Neutrophils (PMNs) and cytokines have a critical role to play in host defense and systemic inflammatory response syndrome (SIRS). Neutrophil extracellular traps (NETs) have been shown to extracellularly kill pathogens, and inflammatory potential of NETs has been shown. Microbial killing
Sambasivan Venkatasubramanian et al.
PLoS pathogens, 11(2), e1004617-e1004617 (2015-02-07)
In this study, we found that a subpopulation of CD4(+)CD25(+) (85% Foxp3(+)) cells from persons with latent tuberculosis infection (LTBI) inhibits growth of M. tuberculosis (M. tb) in human monocyte-derived macrophages (MDMs). A soluble factor, Rho GDP dissociation inhibitor (D4GDI)

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.