콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU022331

Sigma-Aldrich

MISSION® esiRNA

targeting human EDN1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CCAAGGAGCTCCAGAAACAGCAGTCTTAGGCGCTGAGCTCAGCGCGGTGGGTGAGAACGGCGGGGAGAAACCCACTCCCAGTCCACCCTGGCGGCTCCGCCGGTCCAAGCGCTGCTCCTGCTCGTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTGGACATCATTTGGGTCAACACTCCCGAGCACGTTGTTCCGTATGGACTTGGAAGCCCTAGGTCCAAGAGAGCCTTGGAGAATTTACTTCCCACAAAGGCAACAGACCGTGAAAATAGATGCCAATGTGCTAGCCAAAAAGACAAGAAGTGCTGGAATTTTTGCCAAGCAGGAAAAGAACTCAGGGCTGAAGACATTATGGAGAAAGACTGGAATAATCATAAGAAAGGAAAAGACTGTTCCAAGCTTGGGAAAAAGTGTATTTATCAGCAGTTAGTGAGAGGAAGAAAAATCAGAAGAAGTTCAGAGGAACACCTAAGACAAACCAGGTCGGAGA

Ensembl | 인체 수납 번호

ENSG00000078401

NCBI 수납 번호

NM_001955

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... EDN1(1906) , EDN1(1906)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our 문서 section.

도움이 필요하시면 연락하세요. 고객 지원 부서

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Yan Hao et al.
Diabetes, metabolic syndrome and obesity : targets and therapy, 14, 1405-1418 (2021-04-02)
Mesenchymal stem cell (MSC)-derived exosomes have seen great advances in human disease control in a minimally invasive manner. This research aimed to explore the function of MSC-derived exosomes in diabetic nephropathy (DN) progression and the molecules involved. A rat model
Xianwei Wang et al.
Journal of molecular and cellular cardiology, 80, 101-109 (2015-01-15)
Endothelin-1 (ET-1) plays a major role in regulating myocardial fibrosis in several pathological conditions, such as hypertension and diabetes. Aging is an independent risk factor for myocardial fibrosis. We hypothesized that ET-1 upregulation may be a basis of enhanced collagen
Shannon N Acker et al.
Pediatric research, 77(4), 511-519 (2015-01-13)
Pulmonary hypertension (PH) secondary to vascular remodeling contributes to poor outcomes in congenital diaphragmatic hernia (CDH), however mechanisms responsible are unknown. We hypothesized that pulmonary artery endothelial cell (PAEC) dysfunction contributes to smooth muscle cell (SMC) hyperplasia in experimental CDH.

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.