설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GATGCACAGCAGGAGGATTTCGGAATCTTCCAGGCCTGGGCCGAGGCCACTGGTGCATATGTTCCCGGGAGGGATAAGCCAGACCTGCCAACCTGGAAGAGGAATTTCCGCTCTGCCCTCAACCGCAAAGAAGGGTTGCGTTTAGCAGAGGACCGGAGCAAGGACCCTCACGACCCACATAAAATCTACGAGTTTGTGAACTCAGGAGTTGGGGACTTTTCCCAGCCAGACACCTCTCCGGACACCAATGGTGGAGGCAGTACTTCTGATACCCAGGAAGACATTCTGGATGAGTTACTGGGTAACATGGTGTTGGCCCCACTCCCAGATCCGGGACCCCCAAGCCTGGCTGTAGCCCCTGAGCCCTGCCCTCAGCCCCTGCGGAGCCCCAGCTTGGACAATCCCACTCCCTTCCCAAACCTGGGGCCCTCTGAGAACCCACTGAAGCGGCTGTTGGTGCCGGGGGAAGAGTGGGAGTTCGAGGTGACAGCCTTCTACCG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... IRF3(3661) , IRF3(3661)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Nanae Harashima et al.
Molecular cancer, 13, 217-217 (2014-09-18)
Synthetic double-stranded RNA poly(I:C) is a useful immune adjuvant and exhibits direct antitumor effects against several types of cancers. In this study, we elucidated the mechanisms underlying the effects induced in poly(I:C)-transfected human renal cell carcinoma (RCC) cells. In contrast
Xiao-Hua Wang et al.
The international journal of biochemistry & cell biology, 87, 8-17 (2017-03-25)
Respiratory syncytial virus (RSV) is the leading cause of bronchiolitis in infancy, which is a major risk factor for recurrent wheezing and asthma. Orosomucoid 1-like protein 3 (ORMDL3) has been reported to associate with virus-triggered recurrent wheezing and asthma in
Shen Yang et al.
Scientific reports, 6, 29665-29665 (2016-07-15)
SAMHD1 is a type I interferon (IFN) inducible host innate immunity restriction factor that inhibits an early step of the viral life cycle. The underlying mechanisms of SAMHD1 transcriptional regulation remains elusive. Here, we report that inducing SAMHD1 upregulation is
Wenxin Wu et al.
Viruses, 12(4) (2020-04-03)
Influenza A virus (IAV) infection is a major cause of morbidity and mortality. Retinoic acid-inducible protein I (RIG-I) plays an important role in the recognition of IAV in most cell types, and leads to the activation of interferon (IFN). We
Ning Li et al.
Redox biology, 24, 101215-101215 (2019-05-24)
Mountainous evidence suggests that inflammation, cardiomyocyte apoptosis and pyroptosis are involved in the development of sepsis and sepsis-induced cardiomyopathy (SIC). Stimulator of interferon genes (STING) is an indispensable molecule that could regulate inflammation and immune response in multiple diseases. However
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.