설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CTGGAGGAAGTCACACAGCATTGGGAGATAGGAGTTATTCAGAGTCTTCATCTACATCTTCCTCGGAAAGCTTGAATTCATCAGCACCACGTGGAGAACGTTCGATCGCTGGGATTAGCTACGGTCAAGTGCGTGGCACAGCTATTGAACAAAGGACTTCCAGCGACCACACAGACCACACCTACCTGTCATCTACTTTCACCAAAGGAGAACGGGCGTTACTGTCCATTACAGATAACAGTTCATCCTCAGACATTGTGGAGAGCTCAACTTCTTATATTAAAATCTCAAACTCTTCACATTCAGAGTATTCCTCCTTTTTTCATGCTCAGACTGAGAGAAGTAACATCTCATCCTATGACGGGGAATATGCTCAGCCTTCTACTGAGTCGCCAGTTCTGCATACATCCAACCTTCCGTCCTACAC
Ensembl | 인체 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... HEG1(57493) , HEG1(57493)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Tomomi Fujii et al.
Biochemical and biophysical research communications, 526(4), 927-933 (2020-04-15)
Malignant mesothelioma (MM) is a fatal tumor, and the absence of a specific diagnostic marker and/or a pathogenic molecule-targeting drug is a major issue for its pathological diagnosis and for targeting therapy. The molecular target of MM has not been
Shoutaro Tsuji et al.
Scientific reports, 7, 45768-45768 (2017-04-01)
The absence of highly specific markers for malignant mesothelioma (MM) has served an obstacle for its diagnosis and development of molecular-targeting therapy against MM. Here, we show that a novel mucin-like membrane protein, sialylated protein HEG homolog 1 (HEG1), is
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.