콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU015931

Sigma-Aldrich

MISSION® esiRNA

targeting human CARD10

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GATCCTTCAGCAGCATGTCAGACATCACAGGGAGTGTGACACTTAAGCCCTGGTCCCCTGGCCTCTCTTCGTCCTCATCCTCTGACAGCGTGTGGCCTTTGGGAAAGCCGGAAGGCCTCCTGGCTCGGGGCTGTGGCCTGGACTTCCTCAACAGGTCTCTGGCTATTCGGGTGTCTGGCCGGAGCCCCCCAGGGGGCCCAGAGCCGCAGGACAAGGGACCAGATGGACTGTCGTTTTATGGGGACAGATGGTCTGGGGCTGTGGTGCGCAGGGTGCTGTCTGGGCCTGGGTCCGCCAGGATGGAACCAAGAGAGCAAAGGGTGGAAGCTGCTGGTCTGGAGGGGGCGTGCCTGGAAGCCGAGGCCCAGCAGAGAACCTTGCTCTGGAATCAGGGGTCCACACTCCCCTCCCTGATGGACTCGAAGGCCTGCCAGTCCTTCCACGAGGCCCTAGAAGCCTGGGCAAAGGGACCAGGTGCCGAGCCCTTCTACATTCGTGCCAACCTCA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Pavithra Shyamsunder et al.
Haematologica, 103(8), 1269-1277 (2018-05-19)
Maturation of granulocytes is dependent on controlled gene expression by myeloid lineage restricted transcription factors. CEBPE is one of the essential transcription factors required for granulocytic differentiation. Identification of downstream targets of CEBPE is vital to understand better its role
Benjamin Causton et al.
Journal of immunology (Baltimore, Md. : 1950), 195(2), 683-694 (2015-06-05)
Innate immune responses to allergens by airway epithelial cells (AECs) help initiate and propagate the adaptive immune response associated with allergic airway inflammation in asthma. Activation of the transcription factor NF-κB in AECs by allergens or secondary mediators via G
Cheng-Shyuan Rau et al.
Toxicological sciences : an official journal of the Society of Toxicology, 140(2), 315-326 (2014-05-28)
This aim of this study was to explore the role of miRNA-146a (miR-146a) and its target genes in endothelial cells. We demonstrated that lipopolysaccharide (LPS) induced the upregulation of miR-146a in human umbilical vein endothelial cells (HUVECs), and that the

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.