설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
ACTGCAGGCCAGAAAGTCATTAGCAAGCATAAGAACGGGCGCTTCTACCAGTGTGAAGTGGTCAGGCTCACCACCGAGACCTTCTATGAAGTCAACTTTGATGATGGCTCCTTCAGCGACAATCTTTATCCTGAGGACATAGTGAGCCAGGACTGTCTCCAGTTTGGTCCTCCTGCTGAAGGGGAAGTGGTCCAAGTGAGATGGACAGACGGCCAAGTCTATGGAGCCAAGTTTGTGGCCTCCCACCCTATCCAAATGTACCAGGTGGAGTTTGAGGATGGCTCACAACTTGTGGTTAAGAGAGATGATGTATACACACTGGATGAAGAGCTTCCCAAGAGAGTCAAATCTAGACTGTCAGTAGCCTCAGACATGCGCTTCAATGAGATTTTCACAGAGAAAGAGGTTAAGCAAGAAAAGAAACGGCAA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... KDM4A(9682) , JMJD2A(9682)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Haiyu Zhang et al.
Archives of biochemistry and biophysics, 684, 108334-108334 (2020-03-17)
Emerging evidence shows that histone modification and its related regulators are involved in the progression and chemoresistance of ovarian cancer (OC) cells. Our present study found that the expression of Jumonji C domain-containing 2A (JMJD2A), while not JMJD2B or JMJD2C
Antonio Pezone et al.
Nucleic acids research, 48(16), 8943-8958 (2020-07-23)
The epithelial-to-mesenchymal transition (EMT) is a complex transcriptional program induced by transforming growth factor β1 (TGF-β1). Histone lysine-specific demethylase 1 (LSD1) has been recognized as a key mediator of EMT in cancer cells, but the precise mechanism that underlies the
Yi Su et al.
BMC cancer, 17(1), 477-477 (2017-07-12)
Jumonji C domain 2A (JMJD2A), as a histone demethylases, plays a vital role in tumorigenesis and progression. But, its functions and underlying mechanisms of JMJD2A in nasopharyngeal carcinoma (NPC) metabolism are remained to be clarified. In this study, we investigated
Tadahiko Nakagawa et al.
Gastric cancer : official journal of the International Gastric Cancer Association and the Japanese Gastric Cancer Association, 23(3), 426-436 (2019-11-05)
Jumonji domain-containing protein 2A (JMJD2A) of the JMJD2 family of histone lysine demethylases has been implicated in tumorigenesis. However, its expression and role in gastric cancer (GC) drug resistance remain unknown. Here, we investigated the role of JMJD2A in GC
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.