설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TATCTCGGCTTCTCCCTTGAATTCCAGAAAATCTGATCCAGTTACACCCAAGTCTGAAAAGAAAAGTAAGAACAAACAAAGAAACACTGGAGATATTCAGAAGTATTTGACACCGAAATCTCAGTTTGGGTCAGCCTCACACTCTGAAGCTGTACAAGAAGTCAGGAAAGACTCCGTATCTAAGGACATTGACAGTAGTGATAGGAAAAGCCCAACAGGGCAAGACACAGAAATAGAAGATATGCCGACACTTTCTCCACAGATATCCCTTGGAGTTGGAGAACAAGGTGCAGATTCTTCAATAGAGTCCCCTATGCCATGGTTATGTGCCTGTGGTGCCGAATGGTACCATGAAGGAAACGTCAAAACAAGACCAAGCAATCATGGGAAAGAGTTATGTGTCTTAAGTCACGAGCGACCTAAAACCAGA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... RNF168(165918) , RNF168(165918)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Stanimir Dulev et al.
Cell cycle (Georgetown, Tex.), 19(1), 15-23 (2019-11-26)
The DNA damage response (DDR) associated post-translational modifications recruit chromatin remodelers, signaling proteins such as 53BP1 and repair factors to chromatin flanking DNA double strand breaks (DSBs) to promote its repair. Although localization of both RNF168 ubiquitin ligase and SET8
Parasvi S Patel et al.
The Journal of clinical investigation, 131(3) (2021-02-03)
Germline mutations in BRCA1 and BRCA2 (BRCA1/2) genes considerably increase breast and ovarian cancer risk. Given that tumors with these mutations have elevated genomic instability, they exhibit relative vulnerability to certain chemotherapies and targeted treatments based on poly (ADP-ribose) polymerase
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.