콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

모든 문서 보기

EHU009621

Sigma-Aldrich

MISSION® esiRNA

targeting human ERRFI1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

ACCAGCTGGCTCCTTTAACAAGCCAGCCATAAGGATATCCAACTGTTGTATACACAGAGCTTCTCCTAACTCCGATGAAGACAAACCTGAGGTTCCCCCCAGAGTTCCCATACCTCCTAGACCAGTAAAGCCAGATTATAGAAGATGGTCAGCAGAAGTTACTTCGAGCACCTATAGTGATGAAGACAGGCCTCCCAAAGTACCGCCAAGAGAACCTTTGTCACCGAGTAACTCGCGCACACCGAGTCCCAAAAGCCTTCCGTCTTACCTCAATGGGGTCATGCCCCCGACACAGAGCTTTGCCCCTGATCCCAAGTATGTCAGCAGCAAAGCACTGCAAAGACAGAACAGCGAAGGATCTGCCAGTAAGGTTCCTTGCATTCTGCCCATTATTGAAAATGGGAAGAAGGTTAGTTCAACACATTATTACCTACTACCTGAACGACCACCATACCTGGACAAATATGAAAAATTTTTTAGGGAAGCAGAAGAAACAAATGGAGGCGCCCAAATCCAGCCATTACCTGCTG

Ensembl | 인체 수납 번호

ENSG00000116285

NCBI 수납 번호

NM_018948

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... ERRFI1(54206) , ERRFI1(54206)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Da Hyun Kang et al.
BMC cancer, 20(1), 571-571 (2020-06-20)
The resistance of lung cancer to epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI) is one of the unconquered frontiers in chemotherapy. Mitogen-inducible gene 6 (Mig-6) is known to inhibit the kinase activity of epidermal growth factor receptor (EGFR). Similarly, numerous
Soyoung Park et al.
Oncotarget, 7(8), 8916-8930 (2016-01-14)
Hexavalent Chromium [Cr(VI)] compounds are human lung carcinogens and environmental/occupational hazards. The molecular mechanisms of Cr(VI) carcinogenesis appear to be complex and are poorly defined. In this study, we investigated the potential role of Gene 33 (ERRFI1, Mig6), a multifunctional
Zixuan Li et al.
Experimental and molecular pathology, 102(3), 492-499 (2017-05-17)
The ablation of Mig-6 has been shown to induce tumor formation in various tissues. However, the relationships between Mig-6 expression, clinical pathological factors, and prognosis have not been clarified in hepatocellular carcinoma (HCC), and the mechanism by which Mig-6 regulates
Malgorzata Milewska et al.
PloS one, 10(6), e0129859-e0129859 (2015-06-13)
BRAF functions in the RAS-extracellular signal-regulated kinase (ERK) signaling cascade. Activation of this pathway is necessary to mediate the transforming potential of oncogenic BRAF, however, it may also cause a negative feedback that inhibits the epidermal growth factor receptor (EGFR).

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.