콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU009491

Sigma-Aldrich

MISSION® esiRNA

targeting human ZC3H12A

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CACAGTGTTTGTGCCATCCTGGAGGAAGGAGCAGCCTCGGCCCGACGTGCCCATCACAGACCAGCACATCCTGCGGGAACTGGAGAAGAAGAAGATCCTGGTGTTCACACCATCACGACGCGTGGGTGGCAAGCGGGTGGTGTGCTATGACGACAGATTCATTGTGAAGCTGGCCTACGAGTCTGACGGGATCGTGGTTTCCAACGACACATACCGTGACCTCCAAGGCGAGCGGCAGGAGTGGAAGCGCTTCATCGAGGAGCGGCTGCTCATGTACTCCTTCGTCAATGACAAGTTTATGCCCCCTGATGACCCACTGGGCCGGCACGGGCCCAGCCTGGACAACTTCCTGCGTAAGAAGCCACTCACTTTGGAGCACAGGAAGCAGCCGTGTCCCTATGGAAGGAAATGCACCTATGGGATCAAGTGCCGAT

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

You-Take Oh et al.
Oncogene, 37(25), 3415-3425 (2018-03-20)
Monocyte chemotactic protein-induced protein-1 (MCPIP1; also called Regnase-1) encoded by the ZC3H12A gene critically regulates inflammatory responses and immune homeostasis primarily by RNase-dependent and -independent mechanisms. However, the relationship of MCPIP1 with apoptosis and cancer and the underlying mechanisms are
Min Li et al.
Medical microbiology and immunology, 207(1), 27-38 (2017-10-19)
Monocyte chemotactic protein-induced protein 1(MCPIP1) is identified as an important inflammatory regulator during immune response. MCPIP1 possesses antiviral activities against several viruses, such as Japanese encephalitis. However, its role on Coxsackievirus B3 (CVB3) infection, a positive-stranded RNA virus, has not
Zhuqing Jin et al.
International journal of molecular sciences, 20(1) (2019-01-10)
MCP-1-induced protein (MCPIP, also known as Zc3h12a or Regnase-1), a newly identified suppressor of cytokine signaling, is expressed in endothelial cells (ECs). To investigate the role of endothelial MCPIP in vascular homeostasis and function, we deleted the MCPIP gene specifically
Nidhi Kapoor et al.
Journal of immunology (Baltimore, Md. : 1950), 194(12), 6011-6023 (2015-05-03)
Macrophage polarization plays a critical role in tissue homeostasis, disease pathogenesis, and inflammation and its resolution. IL-4-induced macrophage polarization involves induction of STAT6 and Krüppel-like factor 4 (KLF4), which induce each other and promote M2 polarization. However, how these transcription

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.