콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

모든 문서 보기

EHU007981

Sigma-Aldrich

MISSION® esiRNA

targeting human ALOX12

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CACCAAGGAAGATGTGACGATGGCCACAGTGATGGGGTCACTACCTGATGTCCGGCAGGCCTGTCTTCAAATGGCCATCTCATGGCATCTGAGTCGCCGCCAGCCAGACATGGTGCCTCTGGGGCACCACAAAGAAAAATATTTCTCAGGCCCCAAGCCCAAAGCTGTGCTAAACCAATTCCGAACAGATTTGGAAAAGCTGGAAAAGGAGATTACAGCCCGGAATGAGCAACTTGACTGGCCCTATGAATATCTGAAGCCCAGCTGCATAGAGAACAGTGTCACCATCTGAGCCCTAGAGTGACTCTACCTGCAAGATTTCACATCAGCTTTAGGACTGACATTTCTATCTTGAATTTCATGCTTTCCTAAAGTCTCTGCTGCTAAGGCTCTATTTCCTCCCCCAGTTAAACCCCCTACATTAGTATCCCACTAGCCCAGGGGAGCAGTAAACTTTCTCTGCAAAGACTAGATCCTTTTTTACGCTTTGCAGACCGCATAGTCACTGTCTCAACTACTCAGCTCTCCTGCTGCA

Ensembl | 인체 수납 번호

ENSG00000108839

NCBI 수납 번호

NM_000697

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... ALOX12(239) , ALOX12(239)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

William H Witola et al.
Infection and immunity, 82(7), 2670-2679 (2014-04-02)
ALOX12 is a gene encoding arachidonate 12-lipoxygenase (12-LOX), a member of a nonheme lipoxygenase family of dioxygenases. ALOX12 catalyzes the addition of oxygen to arachidonic acid, producing 12-hydroperoxyeicosatetraenoic acid (12-HPETE), which can be reduced to the eicosanoid 12-HETE (12-hydroxyeicosatetraenoic acid).
Ji-Li Li et al.
Biochemical and biophysical research communications, 516(3), 991-998 (2019-07-07)
Spinal cord injury (SCI) is terrible damage leading to the deficiencies and results in infinite inconvenience to sufferers. The effective treatment for SCI still meets a larger number of problems. Herein, the underlying molecular mechanism and novel therapy of SCI
Zhen Huang et al.
Biochemical and biophysical research communications, 514(1), 24-30 (2019-04-25)
Arachidonate lipoxygenase12 (Alox12) and its metabolites 12S-hydroxyeicosatetraenoic acid (12S-HETE) have been implicated in influencing tumor transformation and progression. In this study, we have systematically evaluated the expression, function and the downstream effectors of Alox12 in breast cancer using loss- and

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.