콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU007971

Sigma-Aldrich

MISSION® esiRNA

targeting human UCP2

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CGTCTCCCACCCATTTTCTATGGAAAACCAAGGGGATCGGGCCATGATAGCCACTGGCAGCTTTGAAGAACGGGACACCTTTAGAGAAGCTTGATCTTGGAGGCCTCACCGTGAGACCTTACAAAGCCGGATTCCGGCAGAGTTCCTCTATCTCGTCTTGTTGCTGATTAAAGGTGCCCCTGTCTCCAGTTTTTCTCCATCTCCTGGGACGTAGCAGGAAATCAGCATCATGGTTGGGTTCAAGGCCACAGATGTGCCCCCTACTGCCACTGTGAAGTTTCTTGGGGCTGGCACAGCTGCCTGCATCGCAGATCTCATCACCTTTCCTCTGGATACTGCTAAAGTCCGGTTACAGATCCAAGGAGAAAGTCAGGGGCCAGTGCGCGCTACAGCCAGCGCCCAGTACCGCGGTGTGATGGGCACCATTCTGACCATGGTGCGTACTGAGGGCCCCCGAAGCCTCTACAATGGGCTGGTTGCCGGCCTGCAGCGCCAAATGAGCTTTGCCTCTGTCCGCATCGGCCTGTATGATTCT

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Corina T Madreiter-Sokolowski et al.
Oncotarget, 8(46), 80278-80285 (2017-11-09)
Cancer cells have developed unique strategies to meet their high energy demand. Therefore, they have established a setting of Ca
Anand Kumar Gupta et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 31(11), 5087-5101 (2017-08-03)
In visceral leishmaniasis, we found that the antileishmanial drug Amp B produces a higher level of IL-1β over the infected control. Moreover, administering anti-IL-1β antibody to infected Amp B-treated mice showed significantly less parasite clearance. Investigation revealed that
Rui Zhang et al.
BioMed research international, 2020, 6537371-6537371 (2020-09-17)
As a common disorder, acute kidney injury (AKI) is characterized by high mortality and morbidity, and current therapeutic options for AKI remain limited. Irisin, a muscle factor, plays an important role in metabolic disorders. However, the role of irisin in
Jin Hee Lee et al.
Oncology letters, 20(6), 374-374 (2020-11-07)
The uncoupling protein-2 (UCP2) serves a role in tumor aggressiveness and anticancer resistance, which is considered to be associated with its ability to attenuate reactive oxygen species (ROS) production. We hypothesized that UCP2 may protect cancer cells from elesclomol-induced cytotoxicity
Rebecca F Hough et al.
JCI insight, 4(3) (2019-02-08)
Acid aspiration, which can result from several etiologies, including postoperative complications, leads to direct contact of concentrated hydrochloric acid (HCl) with the alveolar epithelium. As a result, rapid endothelial activation induces alveolar inflammation, leading to life-threatening pulmonary edema. Because mechanisms

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.