콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU007521

Sigma-Aldrich

MISSION® esiRNA

targeting human MARCH8

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TGCATCAGATCTCTGCCATTCCATCCCAGGATGCCATCTCTGCTAGAGTCTACAGAAGTAAGACCAAAGAAAAGGAGAGGGAAGAACAGAATGAGAAGACTTTGGGACATTTCATGAGTCATTCAAGCAACATTTCTAAGGCTGGGAGTCCTCCGTCAGCATCAGCTCCGGCTCCGGTGTCCTCCTTCTCTCGCACTTCTATCACGCCATCCAGCCAGGACATCTGCAGGATCTGCCACTGTGAAGGAGATGATGAGAGCCCCCTGATCACCCCCTGCCACTGCACAGGAAGCCTCCACTTCGTGCACCAGGCCTGCCTGCAGCAGTGGATCAAGAGCTCCGACACGCGCTGCTGCGAGCTCTGCAAGTATGAGTTCATCATGGAGACCAAGCTGAAGCCACTGAGAAAATGGGAGAAGTTGCAGATGACGTCCA

Ensembl | 인체 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Shivam Singh et al.
Cancer cell international, 17, 116-116 (2017-12-08)
Herein, for the first time, we report aberrant expression of membrane-associated RING-CH8 (MARCH8) in human esophageal squamous cell carcinoma. MARCH8 is a member of the recently discovered MARCH family of really interesting new genes (RING) E3 ligases. Though initial studies
Shivam Singh et al.
Journal of proteomics, 236, 104125-104125 (2021-02-05)
MARCH8 is an E3 ligase, primarily involved in immune-modulation. Recently, we reported its aberrant expression in human esophageal squamous cell carcinoma. However, exact mechanisms by which it regulates cancer have been poorly understood. We applied high-throughput quantitative proteomics approach to
Sriganesh B Sharma et al.
Molecular and cellular biology, 34(22), 4143-4164 (2014-09-10)
Despite the low prevalence of activating point mutation of RAS or RAF genes, the RAS-extracellular signal-regulated kinase (ERK) pathway is implicated in breast cancer pathogenesis. Indeed, in triple-negative breast cancer (TNBC), there is recurrent genetic alteration of pathway components. Using

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.