콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU007101

Sigma-Aldrich

MISSION® esiRNA

targeting human CD19

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TGGGTCCTGAGGATGAAGACTCCTTCTCCAACGCTGAGTCTTATGAGAACGAGGATGAAGAGCTGACCCAGCCGGTCGCCAGGACAATGGACTTCCTGAGCCCTCATGGGTCAGCCTGGGACCCCAGCCGGGAAGCAACCTCCCTGGGGTCCCAGTCCTATGAGGATATGAGAGGAATCCTGTATGCAGCCCCCCAGCTCCGCTCCATTCGGGGCCAGCCTGGACCCAATCATGAGGAAGATGCAGACTCTTATGAGAACATGGATAATCCCGATGGGCCAGACCCAGCCTGGGGAGGAGGGGGCCGCATGGGCACCTGGAGCACCAGGTGATCCTCAGGTGGCCAGCCTGGATCTCCTCAAGTCCCCAAGATTCACACCTGACTCTGAAATCTGAAGACCTCGAGCAGATGATGCCAACCTCTGGAGCAATGTT

Ensembl | 인체 수납 번호

ENSG00000177455

NCBI 수납 번호

NM_001770

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... CD19(930) , CD19(930)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Sheng-Dan Nie et al.
Neurobiology of aging, 67, 171-180 (2018-04-21)
High glucose (HG)-induced mammalian target of rapamycin (mTOR) overactivation acts as a signaling hub for the formation of tau hyperphosphorylation, which contributes to the development of diabetes-associated cognitive deficit. How HG induces the sustained activation of mTOR in neurons is
Feng Yan et al.
Experimental neurology, 297, 92-100 (2017-08-02)
Neuronal apoptosis is a central pathological process in subarachnoid hemorrhage (SAH)-induced early brain injury. Previous studies indicated that ErbB4 (EGFR family member v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4) is essential for normal development and maintenance of the nervous
Areumnuri Kim et al.
Oncotarget, 6(35), 38225-38238 (2015-10-31)
Although proteasome inhibition with bortezomib (BTZ) is a validated treatment for relapsed or refractory mantle cell lymphoma (MCL), many patients show resistance to BTZ. However, the molecular mechanism of BTZ resistance in MCL has not been elucidated. In the present
Tai Kiuchi et al.
Science signaling, 7(339), ra78-ra78 (2014-08-21)
The epidermal growth factor receptor (EGFR) is a member of the ErbB family that can promote the migration and proliferation of breast cancer cells. Therapies that target EGFR can promote the dimerization of EGFR with other ErbB receptors, which is

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.