콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

View All Documentation

EHU004761

Sigma-Aldrich

MISSION® esiRNA

targeting human CYP27B1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GGAAATTCTCGTGTCCCAGACAAAGACATTCATGTGGGTGACTATATTATCCCCAAAAATACGCTGGTCACTCTGTGTCACTATGCCACTTCAAGGGACCCTGCCCAGTTCCCAGAGCCAAATTCTTTTCGTCCAGCTCGCTGGCTGGGGGAGGGTCCCACCCCCCACCCATTTGCATCTCTTCCCTTTGGCTTTGGCAAGCGCAGCTGTATGGGGAGACGCCTGGCAGAGCTTGAATTGCAAATGGCTTTGGCCCAGATCCTAACACATTTTGAGGTGCAGCCTGAGCCAGGTGCGGCCCCAGTTAGACCCAAGACCCGGACTGTCCTGGTACCTGAAAGGAGCATCAACCTACAGTTTTTGGACAGATAGTCCCATGGAAAGAGACTGTCATCATCACCCTTTCATTCATCATAGGGATAAGATTTTTTGTAGGCACAAGACCAAGGTATACATCTTCCCCTAATGCCTATCTGACCAAACTGGATAGAACCACCATAGTGAAGTGTGAGGCGGCCCTGACCAATGTGTGAAGTATGCACTTGGCCTG

Ensembl | 인체 수납 번호

ENSG00000111012

NCBI 수납 번호

NM_000785

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... CYP27B1(1594) , CYP27B1(1594)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Hana Sustova et al.
Acta physiologica (Oxford, England), 226(3), e13269-e13269 (2019-03-06)
Loss of skeletal muscle is one of the main features of cancer cachexia. Vitamin D (VD) deficiency is associated with impairment of muscle mass and performance and is highly prevalent in cachectic patients; therefore, VD supplementation has been proposed to
Shuo Geng et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 26(5), 1145-1153 (2011-05-05)
1,25-Dihydroxyvitamin D(3)[1,25(OH)(2)D(3)] has many noncalcemic actions that rest on inhibition of proliferation and promotion of differentiation in malignant and normal cell types. 1,25(OH)(2)D(3) stimulates osteoblast differentiation of human marrow stromal cells (hMSCs), but little is known about the effects of
Kaining Liu et al.
PloS one, 7(6), e39878-e39878 (2012-07-05)
We previously demonstrated that 25-hydroxyvitamin D(3), the precursor of 1α,25-dihydroxyvitamin D(3), is abundant around periodontal soft tissues. Here we investigate whether 25-hydroxyvitamin D(3) is converted to 1α,25-dihydroxyvitamin D(3) in periodontal soft tissue cells and explore the possibility of an autocrine/paracrine
Ken-ichiro Tanaka et al.
Biochemical and biophysical research communications, 450(1), 482-487 (2014-06-14)
Vitamin D deficiency and advanced glycation end products (AGEs) are suggested to be involved in the pathogenesis of osteoporosis and sarcopenia. However, the effects of vitamin D and AGEs on myogenesis and the interaction between muscle and bone remains still
Lars Brodowski et al.
PloS one, 9(6), e98527-e98527 (2014-06-03)
Placenta-derived circulating factors contribute to the maternal endothelial dysfunction underlying preeclampsia. Endothelial colony forming cells (ECFC), a sub-population of endothelial progenitor cells (EPCs), are thought to be involved in vasculogenesis and endothelial repair. Low vitamin D concentrations are associated with
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.