콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU004551

Sigma-Aldrich

MISSION® esiRNA

targeting human STS

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

ATTCATGGCGGAAGTAATGGGATCTATAAAGGAGGAAAAGCAAACAACTGGGAAGGAGGTATCCGGGTTCCAGGCATCCTTCGTTGGCCCAGGGTGATACAGGCTGGCCAGAAGATTGATGAGCCCACTAGCAACATGGACATATTTCCTACAGTAGCCAAGCTGGCTGGAGCTCCCTTGCCTGAGGACAGGATCATTGATGGACGTGATCTGATGCCCCTGCTTGAAGGAAAAAGCCAACGCTCCGATCATGAGTTTCTCTTCCATTACTGCAACGCCTACTTAAATGCTGTGCGCTGGCACCCTCAGAACAGCACATCCATCTGGAAGGCCTTTTTCTTCACCCCCAACTTCAACCCCGTGGGTTCCAACGGATGCTTTGCCACACACGTGTGCTTCTGTTTCGGGAGTTATGTCACCCATCACGACCCACCTTTAC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... STS(412) , STS(412)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Hee-Jung Im et al.
Biomolecules & therapeutics, 20(6), 556-561 (2013-09-07)
Steroid sulfatase (STS) is responsiblefor the conversion of estrone sulfate to estrone that can stimulate growth in endocrine-dependent tumors such as prostate cancer. Although STS is considered as a therapeutic target for the estrogen-dependent diseases, cellular function of STS are
Amy M Gratton et al.
Placenta, 48, 72-79 (2016-11-23)
Preeclampsia is a serious complication of pregnancy affecting 5% of pregnancies. Our team identified 137 genes highly expressed in placenta relative to other human tissues. Here, we have explored a role for steroid sulfatase (STS) in preeclampsia by characterising STS
Cameron M Armstrong et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 26(22), 6064-6074 (2020-09-16)
Most patients with prostate cancer receiving enzalutamide or abiraterone develop resistance. Clinical evidence indicates that serum levels of dehydroepiandrosterone sulfate (DHEAS) and biologically active DHEA remain in the high range despite antiandrogen treatment. The conversion of DHEAS into DHEA by
Mengxi Jiang et al.
Journal of hepatology, 64(1), 44-52 (2015-07-30)
Chronic inflammatory liver diseases are associated with estrogen excess and feminization in men, which is thought to be due to compromised liver function to break down estrogens. The goal of this study is to determine whether the inflammatory induction of

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.