콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU003961

Sigma-Aldrich

MISSION® esiRNA

targeting human USP13

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

AGATCGCCTGATGAACCAATTGATAGACCCATCAGACATCGATGAGTCATCAGTGATGCAGCTGGCCGAGATGGGTTTCCCGCTGGAAGCATGTCGCAAGGCTGTGTACTTCACTGGAAATATGGGCGCCGAGGTGGCCTTCAACTGGATCATTGTTCACATGGAAGAGCCAGATTTTGCTGAGCCGCTGACCATGCCTGGTTATGGAGGGGCAGCTTCTGCTGGAGCCTCTGTTTTTGGTGCTTCTGGACTGGATAACCAACCTCCAGAGGAAATCGTAGCTATCATCACCTCCATGGGATTTCAGCGAAATCAGGCTATTCAGGCACTACGAGCAACGAATAATAACCTGGAAAGAGCACTGGATTGGATCTTTAGCCACCCTGAGTTTGAAGAAGACAGTGATTTTGTGATTGAGATGGAGAATAATGCCAATGCA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

관련 카테고리

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Yue Wu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 114, 108831-108831 (2019-04-16)
USP13 is emerging as a potential target in cancer therapy. However, the effect of USP13 on tumor progression is controversial. Here we focused on non-small cell lung cancer (NSCLC), a common cancer with high mortality, and studied the role of
Yuning Liao et al.
Journal of experimental & clinical cancer research : CR, 38(1), 157-157 (2019-04-13)
Prostate cancer (PCa) remains a challenge worldwide. Due to the development of castration-resistance, traditional first-line androgen deprivation therapy (ADT) became powerlessness. Epidermal growth factor receptor (EGFR) is a well characterized therapeutic target to treat colorectal carcinoma and non-small cell lung
Xiaoguang Fang et al.
The Journal of experimental medicine, 214(1), 245-267 (2016-12-08)
Glioblastoma is the most lethal brain tumor and harbors glioma stem cells (GSCs) with potent tumorigenic capacity. The function of GSCs in tumor propagation is maintained by several core transcriptional regulators including c-Myc. c-Myc protein is tightly regulated by posttranslational
Shan Gao et al.
Frontiers in cell and developmental biology, 8, 587389-587389 (2020-11-17)
Hepatocellular carcinoma (HCC) is one of the leading causes of cancer death worldwide. The activation of the toll-like receptor 4/myeloid differentiation primary response gene 88/nuclear factor-κB (TLR4/MyD88/NF-κB) pathway contributes to the development and progression of HCC. The ubiquitin-proteasome system regulates

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.