콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU002541

Sigma-Aldrich

MISSION® esiRNA

targeting human CXCL10

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CCACGTGTTGAGATCATTGCTACAATGAAAAAGAAGGGTGAGAAGAGATGTCTGAATCCAGAATCGAAGGCCATCAAGAATTTACTGAAAGCAGTTAGCAAGGAAAGGTCTAAAAGATCTCCTTAAAACCAGAGGGGAGCAAAATCGATGCAGTGCTTCCAAGGATGGACCACACAGAGGCTGCCTCTCCCATCACTTCCCTACATGGAGTATATGTCAAGCCATAATTGTTCTTAGTTTGCAGTTACACTAAAAGGTGACCAATGATGGTCACCAAATCAGCTGCTACTACTCCTGTAGGAAGGTTAATGTTCATCATCCTAAGCTATTCAGTAATAACTCTACCCTGGCACTATAATGTAAGCTCTACTGAGGTGCTATGTTCTTAGTGGATGTTCTGACCCTGCTTCAAATATTTCCCTCACCTTTCCCATCTTCCA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Yi Fu et al.
International immunopharmacology, 75, 105783-105783 (2019-08-04)
Myrothecine A, characterized from the extracts of myrothecium roridum strain IFB-E012, isolated as endophytic fungi found in the traditional Chinese medicinal plant Artemisia annua. Here we investigated its roles on anti-tumor and immune regulation in vitro. Dendritic cells (DCs) are
Katrina K Au et al.
Gynecologic oncology, 145(3), 436-445 (2017-03-21)
We recently established that high STAT1 expression and associated T helper type I tumour immune microenvironment (TME) are prognostic and chemotherapy response predictive biomarkers in high-grade serous ovarian cancer (HGSC). STAT1 induced chemokine CXCL10 is key to the recruitment of
Xiuming Wu et al.
Molecular and cellular endocrinology, 512, 110866-110866 (2020-05-18)
Although 70% of estrogen receptor (ER)-positive breast cancer patients can benefit from tamoxifen therapy, the rapid development of tamoxifen resistance hampers the treatment advantage. In this investigation, we found that the serum level of CXCL10 in breast cancer patients was
Jon Cogan et al.
Molecular therapy : the journal of the American Society of Gene Therapy, 22(10), 1741-1752 (2014-08-27)
Patients with recessive dystrophic epidermolysis bullosa (RDEB) have severe, incurable skin fragility, blistering, and multiple skin wounds due to mutations in the gene encoding type VII collagen (C7), the major component of anchoring fibrils mediating epidermal-dermal adherence. Nearly 10-25% of

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.