설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GCTCTTACTGCCAGGGACTGATGATGGTTAAACCCTGTGGCGGTTACTGCAATGTGGTCATGCAAGGCTGTATGGCAGGTGTGGTGGAGATTGACAAGTACTGGAGAGAATACATTCTGTCCCTTGAAGAACTTGTGAATGGCATGTACAGAATCTATGACATGGAGAACGTACTGCTTGGTCTCTTTTCAACAATCCATGATTCTATCCAGTATGTCCAGAAGAATGCAGGAAAGCTGACCACCACTATTGGCAAGTTATGTGCCCATTCTCAACAACGCCAATATAGATCTGCTTATTATCCTGAAGATCTCTTTATTGACAAGAAAGTATTAAAAGTTGCTCATGTAGAACATGAAGAAACCTTATCCAGCCGAAGAAGGGAACTAATTCAGAAGTTGAAGTCTTTCATCAGCTTCTATAGTGCTTTGCCTGGCTACAT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... GPC3(2719) , GPC3(2719)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
적합한 제품을 찾을 수 없으신가요?
당사의 제품 선택기 도구.을(를) 시도해 보세요.
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Oncology letters, 15(6), 9081-9086 (2018-05-29)
Lung cancer is a major cause of death worldwide, and non-small cell lung cancer (NSCLC) is the most common type of lung cancer. The aim of this study was to investigate whether miR-96 mediated the invasion and metastasis of NSCLC
Autophagy suppresses proliferation of HepG2 cells via inhibiting glypican-3/wnt/β-catenin signaling.
OncoTargets and therapy, 11, 193-200 (2018-01-31)
Autophagy plays an important role in the growth and survival of hepatocellular carcinoma (HCC) cells through several target proteins or signaling pathways. Glypican-3 (GPC3) is a new reliable HCC marker, which is involved in tumor growth in HCC, primarily mediated
Biomaterials science, 5(12), 2468-2479 (2017-11-07)
Hepatocellular carcinoma (HCC) is one of the most common malignancies imposing a serious threat to human health worldwide. To date, the effect of HCC chemotherapy has been limited due to drug resistance. Combination therapy of chemotherapeutic drugs and siRNA represents
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.