Skip to Content
Merck
All Photos(1)

Key Documents

EHU136041

Sigma-Aldrich

MISSION® esiRNA

targeting human FZD2

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTCCTCAAGGTGCCATCCTATCTCAGCTACAAGTTTCTGGGCGAGCGTGATTGTGCTGCGCCCTGCGAACCTGCGCGGCCCGATGGTTCCATGTTCTTCTCACAGGAGGAGACGCGTTTCGCGCGCCTCTGGATCCTCACCTGGTCGGTGCTGTGCTGCGCTTCCACCTTCTTCACTGTCACCACGTACTTGGTAGACATGCAGCGCTTCCGCTACCCAGAGCGGCCTATCATTTTTCTGTCGGGCTGCTACACCATGGTGTCGGTGGCCTACATCGCGGGCTTCGTGCTCCAGGAGCGCGTGGTGTGCAACGAGCGCTTCTCCGAGGACGGTTACCGCACGGTGGTGCAGGGCACCAAGAAGGAGGGCTGCACCATCCTCTTCATGATGCTCTACTTCTTCAGCATGGCCAGCTCCATCTGGTGGGTCATCCTGTC

Ensembl | human accession no.

ENSG00000180340

NCBI accession no.

NM_001466

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... FZD2(2535) , FZD2(2535)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xiang Hu et al.
The Turkish journal of gastroenterology : the official journal of Turkish Society of Gastroenterology, 31(2), 167-179 (2020-03-07)
Autophagy plays a positive role in the prevention of liver damage after hepatic ischemia-reperfusion injury (HIRI); however, the molecular mechanism is still a mystery. Understanding the molecular events behind this injury may have important implications for devising proper strategies for
Martin Golkowski et al.
Cell systems, 11(2), 196-207 (2020-08-07)
Hepatocellular carcinoma (HCC) is a complex and deadly disease lacking druggable genetic mutations. The limited efficacy of systemic treatments for advanced HCC implies that predictive biomarkers and drug targets are urgently needed. Most HCC drugs target protein kinases, indicating that
Norihiro Chatani et al.
Liver international : official journal of the International Association for the Study of the Liver, 35(8), 2017-2026 (2014-12-10)
Obesity-related adipocytokine dysregulation is known to accelerate liver fibrosis progression. Recently, a natural Wnt5a inhibitor, secreted frizzled-related protein 5 (Sfrp5), was identified as a novel adipocytokine that has reduced expression in obese adipose tissue in both rodents and human. In

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service