HSTUD1491
MISSION® Synthetic microRNA Inhibitor, Human
hsa-miR-4484
About This Item
product line
MISSION®
form
solid
mature sequence
AAAAGGCGGGAGAAGCCCCA
Sanger mature/minor accession no.
Sanger microRNA accession no.
storage temp.
−20°C
General description
The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.
- Long lasting inhibition at very low dosage
- Excellent resistance to cellular nucleases
- Custom synthesis available for a variety of species
Two negative controls are available: Arabidopsis thaliana sequence (NCSTUD001) and Caenorhabditis elegans sequence (NCSTUD002)
Other Notes
Legal Information
Signal Word
Warning
Hazard Statements
Precautionary Statements
Hazard Classifications
STOT RE 2 Inhalation
Target Organs
Respiratory Tract
Storage Class Code
11 - Combustible Solids
WGK
WGK 3
Flash Point(F)
Not applicable
Flash Point(C)
Not applicable
Regulatory Listings
Regulatory Listings are mainly provided for chemical products. Only limited information can be provided here for non-chemical products. No entry means none of the components are listed. It is the user’s obligation to ensure the safe and legal use of the product.
PRTR
Class I Designated Chemical Substances
JAN Code
HSTUD1491:
Choose from one of the most recent versions:
Certificates of Analysis (COA)
It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.
If you need assistance, please contact Customer Support.
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service