Skip to Content
Merck
All Photos(1)

Key Documents

Safety Information

EMU201271

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Pcsk6

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGATTAGCCAAAAGACATCTGATGGCCAGGCAGTTCCATAAACATGCAAAGCCAGCCCCTGAATCACTAGTCGCCAGCCCTCCATGGCACACAACTGCTTTTCAAGTGTATTTGGCCTCTGCACTCGGGACTCTCTGTTCTTGGGTGGATGCTGCGCTGGTCCAGTATGGTACAAGCCTACATGATAGAGCTGGATTGATTTTTCTGCCAAGCCTGTGTGGGCATTTTATAAGCTACGTGTTCTAATTTTTACCGATGTTAATTATTTTGACAAATATTTCATATATTTTCATTGAAATGCGCAAATCCGCTTGCTCAGTTCCCTGAGCTAAGGGAATAACACTTGCCTTAAATTTCCCCAACCTCGTCTCTCTCCACATGGTCCTGCTCTCCTCTCTGACTGTAATGTGTTTGTCTTGTCACCTGTAGGTGGCAAGGACTCAGCTGTTGTCTGTTGAATCCACACTTCAAATAAGAAATCAGTGAAGCAAATCTAATGTTAACCCTGA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Regulatory Listings

Regulatory Listings are mainly provided for chemical products. Only limited information can be provided here for non-chemical products. No entry means none of the components are listed. It is the user’s obligation to ensure the safe and legal use of the product.

JAN Code

EMU201271-50UG:
EMU201271-20UG:


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jian Fu et al.
Molecular carcinogenesis, 54(9), 698-706 (2014-01-18)
Proprotein convertases (PC), a family of serine proteases, process cancer-related substrates such as growth factors, growth factor receptors, cell adhesion molecules, metalloproteinases, etc. HIF-1α is a major transcription factor involved in tumorigenesis by sensing intratumoral hypoxia. Furin (PCSK3) is one
Zhiyong Yao et al.
Drug design, development and therapy, 9, 5911-5923 (2015-11-26)
PACE4 is a proprotein convertase capable of processing numerous substrates involved in tumor growth, invasion, and metastasis. However, the precise role of PACE4 during prostate cancer cell apoptosis has not been reported. In the present study, human prostate cancer cell
Huiyu Jiang et al.
Molecular medicine reports, 12(5), 7681-7686 (2015-10-16)
The aim of the present study was to assess the effects of pro-protein convertase subtilisin/kexin type 6 (PCSK6), a proteinase implicated in the proteolytic activity of various precursor proteins and involved in the regulation of protein maturation, in fibroblast‑like synoviocytes

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service