Skip to Content
Merck
All Photos(1)

Key Documents

Safety Information

EMU175511

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ensmusg00000055408

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAAAGAGACGAAGTACGGTTCCAGGCTCCAATTCTCGGAGACTCTCGGAGACTCGAGGGCAGTTTACATACAGGTCAGACACGCTGGAGGCCAAGGTCAAGTTGAAAGTTGCTGTCTAGTCAGCGTGAGAAACTACAATGAAAGCCCAGAGACAGAGCCGACTGCCCACCTCCCCTCGCTCTCAATTCCCCCATCCTTTGCTATCTGGCTTCTGGCTCTGTTTGGTTTCTCAGCATCTTTTTTTTTTCCCTCTCTCTTTGTAGAGTTTTGGGGGCGGTGTTTACAGGCTGGACTGGTTCTTTTCTGTCGGCCGCCCTGCTCTTAGCTGGGTTTCTGAACCTCCGAAGTTTTCCAGCTAGGTTCGGAAAAAACGAAAACACAGCTCAGGAAGGCTCCACCAGCCGATGCCTATGCCAGTTCACCTCTGGCAGTGGCTGTACTGCTGGTCCACACAGCAGCCAAGACCAGCTCCACGTTCTTTCCTCCCCCTCAGTTCACTGGAGCCGGGAG

shipped in

ambient

storage temp.

−20°C

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Regulatory Listings

Regulatory Listings are mainly provided for chemical products. Only limited information can be provided here for non-chemical products. No entry means none of the components are listed. It is the user’s obligation to ensure the safe and legal use of the product.

JAN Code

EMU175511-50UG:
EMU175511-20UG:


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

H-P Deng et al.
Cellular and molecular biology (Noisy-le-Grand, France), 61(4), 34-40 (2015-08-13)
Lung cancer is one of the leading causes of cancer-related deaths worldwide. Early diagnosis is the best defense against this threat and is therefore of vital importance. In this study, we investigated the role of long non-coding RNA HOTTIP in
Yunxia Ge et al.
PLoS genetics, 11(12), e1005726-e1005726 (2015-12-29)
Accumulated evidence demonstrated that long non-coding RNAs (lncRNAs) play a pivotal role in tumorigenesis. However, it is still largely unknown how these lncRNAs were regulated by small ncRNAs, such as microRNAs (miRNAs), at the post-transcriptional level. We here use lncRNA

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service