Skip to Content
Merck
All Photos(1)

Documents

EMU091061

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Rbpj

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCTATGGCAACAGCGATGACATTGGTGTGTTCCTCAGCAAGCGGATAAAGGTCATCTCCAAACCCTCCAAAAAGAAGCAGTCACTGAAGAATGCTGACTTGTGCATTGCTTCAGGAACGAAGGTGGCACTGTTCAATCGCCTTCGGTCCCAGACAGTTAGTACCAGGTACCTGCATGTAGAAGGAGGGAATTTCCACGCCAGTTCACAACAGTGGGGAGCATTTTACATCCATCTCTTGGACGACGACGAGTCGGAAGGAGAGGAGTTCACAGTTAGAGATGGCTACATCCATTACGGGCAGACTGTCAAGCTTGTGTGCTCAGTGACTGGCATGGCACTCCCAAGATTGATAATTAGGAAAGTTGATAAGCAGACGGCATTACTGGATGCAGACGACCCTGTAT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

M Tanaka et al.
British journal of cancer, 100(12), 1957-1965 (2009-05-21)
The study shows constitutive activation of the Notch pathway in various types of malignancies. However, it remains unclear how the Notch pathway is involved in the pathogenesis of osteosarcoma. We investigated the expression of the Notch pathway molecules in osteosarcoma
Hideya Onishi et al.
Cancer letters, 371(2), 143-150 (2015-12-15)
We previously demonstrated that Hedgehog (Hh) signaling is activated under hypoxia through upregulation of transcription of Smoothened (SMO) gene. However, the mechanism of hypoxia-induced activation of SMO transcription remains unclear. In the analysis of altered expressions of genes related to
Hiroko Nagao et al.
PloS one, 7(7), e39268-e39268 (2012-07-14)
The Notch pathway regulates a broad spectrum of cell fate decisions and differentiation processes during fetal and postnatal development. In addition, the Notch pathway plays an important role in controlling tumorigenesis. However, the role of RBPJ, a transcription factor in
Hirokuni Akahori et al.
Nature communications, 6, 7792-7792 (2015-08-06)
Macrophages are an essential component of the immune response to ischaemic injury and play an important role in promoting inflammation and its resolution, which is necessary for tissue repair. The type I transmembrane glycoprotein CD163 is exclusively expressed on macrophages
Robert J Lake et al.
PLoS genetics, 10(3), e1004204-e1004204 (2014-03-08)
Mechanisms that maintain transcriptional memory through cell division are important to maintain cell identity, and sequence-specific transcription factors that remain associated with mitotic chromatin are emerging as key players in transcriptional memory propagation. Here, we show that the major transcriptional

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service