Skip to Content
Merck
All Photos(1)

Key Documents

EMU034911

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Abcb1a

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGCCCTGTTCTTGGACTGTCAGCTGGTATTTGGGCAAAGATATTGTCTTCATTTACTGATAAGGAACTCCATGCTTATGCAAAAGCTGGAGCAGTTGCTGAAGAAGTCTTAGCAGCCATCAGAACTGTGATTGCGTTTGGAGGACAAAAGAAGGAACTTGAAAGGTACAATAACAACTTGGAAGAAGCTAAAAGGCTGGGGATAAAGAAAGCTATCACGGCCAACATCTCCATGGGTGCAGCTTTTCTCCTTATCTATGCATCATATGCTCTGGCATTCTGGTATGGGACTTCCTTGGTCATCTCCAAAGAATACTCTATTGGACAAGTGCTCACTGTCTTCTTTTCCGTGTTAATTGGAGCATTCAGTGTTGGACAGGCATCTCCAAATATTGAAGCCTTCGCCAATGCACGAGGAGCAGCTTATGAAGTCTTCAAAATAATTGATAATAAGCCCAGTATAGACAGCTTCTCAAAGAGTGGGCAC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Nadejda Sigal et al.
Infection and immunity, 83(6), 2358-2368 (2015-04-01)
Human multidrug efflux transporters are known for their ability to extrude antibiotics and toxic compounds out of cells, yet accumulating data indicate they have additional functions in diverse physiological processes not related to drug efflux. Here, we show that the
Patric J Jansson et al.
The Journal of biological chemistry, 290(15), 9588-9603 (2015-02-28)
Multidrug resistance (MDR) is a major obstacle in cancer treatment. More than half of human cancers express multidrug-resistant P-glycoprotein (Pgp), which correlates with a poor prognosis. Intriguingly, through an unknown mechanism, some drugs have greater activity in drug-resistant tumor cells

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service