Skip to Content
Merck
All Photos(1)

Key Documents

EHU153561

Sigma-Aldrich

MISSION® esiRNA

targeting human COL1A1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTCCTGGCAAAGATGGACTCAACGGTCTCCCTGGCCCCATTGGGCCCCCTGGTCCTCGCGGTCGCACTGGTGATGCTGGTCCTGTTGGTCCCCCCGGCCCTCCTGGACCTCCTGGTCCCCCTGGTCCTCCCAGCGCTGGTTTCGACTTCAGCTTCCTGCCCCAGCCACCTCAAGAGAAGGCTCACGATGGTGGCCGCTACTACCGGGCTGATGATGCCAATGTGGTTCGTGACCGTGACCTCGAGGTGGACACCACCCTCAAGAGCCTGAGCCAGCAGATCGAGAACATCCGGAGCCCAGAGGGCAGCCGCAAGAACCCCGCCCGCACCTGCCGTGACCTCAAGATGTGCCACTCTGACTGGAAGAGTGGAGAGTACTGGATTGACCCCAACCAAGGCTGCAACCTGGATGCCATCAAAGTCTTCTGCAACATGGAGACTGGTGAGACCTGCGTGTACCCCACTCAGCCCAGTGTGGCCCAGAAGAACTGGTACATCAGCAAGAACCCCAAGGACAAGAGGCATGTCTGGTTCGGCGAGAGCATGACCGATGGATT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zheying Zhang et al.
International journal of oncology, 53(5), 1869-1880 (2018-08-23)
Colorectal cancer (CRC) treatment primarily relies on chemotherapy along with surgery, radiotherapy and, more recently, targeted therapy at the late stages. However, chemotherapeutic drugs have high cytotoxicity, and the similarity between the effects of these drugs on cancerous and healthy
Jing Liu et al.
Discovery medicine, 25(139), 211-223 (2018-06-16)
Extracellular matrix (ECM) is an important component of tumor microenvironment and plays critical roles in cancer development and metastasis, in which collagen is the major structural protein. Collagen type I alpha 1 (COL1A1) is reportedly associated with the development of
Catherine M Willis et al.
PloS one, 9(8), e103966-e103966 (2014-08-05)
Expression of the glycosaminoglycan chondroitin sulfate-E (CS-E) is misregulated in many human cancers, including breast cancer. Cell-surface associated CS-E has been shown to have pro-tumorigenic functions, and pharmacological treatment with exogenous CS-E has been proposed to interfere with tumor progression
Gennaro Di Maro et al.
The Journal of clinical endocrinology and metabolism, 99(9), E1617-E1626 (2014-05-23)
Anaplastic thyroid carcinoma (ATC) is one of the most aggressive human tumors. Twist1 is a basic helix-loop-helix transcription factor involved in cancer development and progression. We showed that Twist1 affects thyroid cancer cell survival and motility. We aimed to identify

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service