Skip to Content
Merck
All Photos(1)

Key Documents

EHU145431

Sigma-Aldrich

MISSION® esiRNA

targeting human AICDA

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
¥38,100
50 μG
¥68,300

¥38,100


Estimated to ship onMay 21, 2025



Select a Size

Change View
20 μG
¥38,100
50 μG
¥68,300

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

¥38,100


Estimated to ship onMay 21, 2025


description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATTGCTCTTCCTCCGCTACATCTCGGACTGGGACCTAGACCCTGGCCGCTGCTACCGCGTCACCTGGTTCACCTCCTGGAGCCCCTGCTACGACTGTGCCCGACATGTGGCCGACTTTCTGCGAGGGAACCCCAACCTCAGTCTGAGGATCTTCACCGCGCGCCTCTACTTCTGTGAGGACCGCAAGGCTGAGCCCGAGGGGCTGCGGCGGCTGCACCGCGCCGGGGTGCAAATAGCCATCATGACCTTCAAAGATTATTTTTACTGCTGGAATACTTTTGTAGAAAACCACGAAAGAACTTTCAAAGCCTGGGAAGGGCTGCATGAAAATTCAGTTCGTCTCTCCAGACAGCTTCGGCGCATCCTTTTGCCCCTGTATGAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Grant Godsmark et al.
Anticancer research, 41(1), 237-247 (2021-01-10)
Activation-induced cytidine deaminase (AID) is a DNA modifying enzyme which has an essential function in promoting antibody diversification. Its overexpression is strongly associated with B-cell derived malignancies including Burkitt lymphoma, where AID is required for the characteristic c-MYC/IGH translocation. This
Xudong Ao et al.
Cytotechnology, 68(6), 2637-2648 (2016-08-11)
DNA methylation in mammals is an epigenetic marker and necessary for normal embryogenesis. The global genomic demethylation of 5-methylcytosine occurs during the first cell cycle following fertilization. Activation-induced cytidine deaminase (AID), which is well-known for the function in antibody diversification
Yugo Sawai et al.
Cancer research, 75(16), 3292-3301 (2015-06-27)
Pancreatic ductal adenocarcinoma (PDAC) develops via an accumulation of various gene mutations. The mechanism underlying the mutations in PDAC development, however, is not fully understood. Recent insight into the close association between the mutation pattern of various cancers and specific

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service