Skip to Content
Merck
All Photos(1)

Key Documents

EHU128201

Sigma-Aldrich

MISSION® esiRNA

targeting human DEPDC1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTTGCCATCGATGCTCTACAGTTATGTTGTTTGTTACTTCCCCCACCAAATCGTAGAAAGCTTCAACTTTTAATGCGTATGATTTCCCGAATGAGTCAAAATGTTGATATGCCCAAACTTCATGATGCAATGGGTACGAGGTCACTGATGATACATACCTTTTCTCGATGTGTGTTATGCTGTGCTGAAGAAGTGGATCTTGATGAGCTTCTTGCTGGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Anna Tosi et al.
Oncoimmunology, 6(8), e1313371-e1313371 (2017-09-19)
The identification of universal tumor-specific antigens shared between multiple patients and/or multiple tumors is of great importance to overcome the practical limitations of personalized cancer immunotherapy. Recent studies support the involvement of DEPDC1 in many aspects of cancer traits, such
Alboukadel Kassambara et al.
PloS one, 8(4), e62752-e62752 (2013-05-07)
High throughput DNA microarray has made it possible to outline genes whose expression in malignant plasma cells is associated with short overall survival of patients with Multiple Myeloma (MM). A further step is to elucidate the mechanisms encoded by these
Ryogo Kikuchi et al.
Journal of neuro-oncology, 133(2), 297-307 (2017-05-31)
DEP domain containing 1 (DEPDC1) is a novel oncoantigen expressed in cancer cells, which presents oncogenic activity and high immunogenicity. Although DEPDC1 has been predicted to be a useful antigen for the development of a cancer vaccine, its pathophysiological roles

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service