Skip to Content
Merck
All Photos(1)

Key Documents

EHU099041

Sigma-Aldrich

MISSION® esiRNA

targeting human CBS

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGTGATGCCAGAGAAGATGAGCTCCGAGAAGGTGGACGTGCTGCGGGCACTGGGGGCTGAGATTGTGAGGACGCCCACCAATGCCAGGTTCGACTCCCCGGAGTCACACGTGGGGGTGGCCTGGCGGCTGAAGAACGAAATCCCCAATTCTCACATCCTAGACCAGTACCGCAACGCCAGCAACCCCCTGGCTCACTACGACACCACCGCTGATGAGATCCTGCAGCAGTGTGATGGGAAGCTGGAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Liam J O'Connor et al.
ACS central science, 3(1), 20-30 (2017-02-06)
Azide-containing compounds have broad utility in organic synthesis and chemical biology. Their use as powerful tools for the labeling of biological systems
Xingji You et al.
Reproduction (Cambridge, England), 153(5), 535-543 (2017-02-12)
Recent evidence suggests that uterine activation for labor is associated with inflammation within uterine tissues. Hydrogen sulfide (H
Amanda R Jensen et al.
Shock (Augusta, Ga.), 53(6), 737-743 (2019-07-28)
Hydrogen sulfide (H2S) has many beneficial biological properties, including the ability to promote vasodilation. It has been shown to be released from stem cells and increased by hypoxia. Therefore, H2S may be an important paracrine factor in stem cell-mediated intestinal
Mingqi Wang et al.
Biochemical pharmacology, 172, 113775-113775 (2019-12-25)
Hydrogen sulfide (H2S) has been frequently implicated in tumor progression. However, the exact regulation mechanism of H2S in human non-small cell lung cancer (NSCLC) has not been fully elucidated. Here, analysis of NSCLC biopsies and adjacent non-tumor tissues revealed selectively
Xiangning Yuan et al.
Kidney & blood pressure research, 42(3), 428-443 (2017-07-28)
Renal tubulointerstitial fibrosis (TIF) is the common pathway of progressive chronic kidney disease. Inflammation has been widely accepted as the major driving force of TIF. Cystathionine β-synthase (CBS) is the first and rate-limiting enzyme in the transsulfuration pathway. CBS is

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service