Skip to Content
Merck
All Photos(1)

Documents

EHU093561

Sigma-Aldrich

MISSION® esiRNA

targeting human MYCN (1)

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACGTGGTCACTGTGGAGAAGCGGCGTTCCTCCTCCAACACCAAGGCTGTCACCACATTCACCATCACTGTGCGTCCCAAGAACGCAGCCCTGGGTCCCGGGAGCAGTCCAGCGAGCTGATCCTCAAACGATGCCTTCCCATCCACCAGCAGCACAACTATGCCGCCCCCTCTCCCTACGTGGAGAGTGAGGATGCACCCCCACAGAAGAAGATAAAGAGCGAGGCGTCCCCACGTCCGCTCAAGAGTGTCATCCCCCCAAAGGCTAAGAGCTTGAGCCCCCGAAACTCTGACTCGGAGGACAGTGAGCGTCGCAGAAACCACAACATCCTGGAGCGCCAGCGCCGCAACGACCTTCGGTCCAGCTTTCTCAC

Ensembl | human accession no.

ENSG00000134323

NCBI accession no.

NM_005378

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MYCN(4613) , MYCN(4613)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yosuke Watanabe et al.
Medical oncology (Northwood, London, England), 34(9), 158-158 (2017-08-10)
Although DNA hypermethylation at non-promoter region of the Zygote arrest 1 (ZAR1) gene has been observed in many types of tumor, including neuroblastoma (NB), the role of this gene in tumor development and/or progression is unclear. One reason is that
Luca Montemurro et al.
Cancer research, 79(24), 6166-6177 (2019-10-17)
Approximately half of high-risk neuroblastoma is characterized by MYCN amplification. N-Myc promotes tumor progression by inducing cell growth and inhibiting differentiation. MYCN has also been shown to play an active role in mitochondrial metabolism, but this relationship is not well
Huogang Wang et al.
Oncotarget, 8(49), 86312-86324 (2017-11-22)
Small cell lung cancer (SCLC) is a clinically aggressive cancer with very poor prognosis. Amplification of
Xiaoqin Jiang et al.
Molecular medicine reports, 18(5), 4595-4602 (2018-09-18)
Hypoxic‑ischemic encephalopathy is one of the most notable causes of brain injury in newborns. Cerebral ischemia and reperfusion lead to neuronal damage and neurological disability. In vitro and in vivo analyses have indicated that E3 ubiquitin protein ligase (Huwe1) is important for
T Tao et al.
Oncogene, 36(27), 3852-3867 (2017-03-07)
The nucleolar factor, digestive organ expansion factor (DEF), has a key role in ribosome biogenesis, functioning in pre-ribosomal RNA (pre-rRNA) processing as a component of the small ribosomal subunit (SSU) processome. Here we show that the peripheral sympathetic nervous system
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service