Skip to Content
Merck
All Photos(1)

Key Documents

EHU079561

Sigma-Aldrich

MISSION® esiRNA

targeting human HMGCR

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCATTTGACAGCACTAGCAGATTTGCACGTCTACAGAAACTTCATACAAGTATAGCTGGACGCAACCTTTATATCCGTTTCCAGTCCAGGTCAGGGGATGCCATGGGGATGAACATGATTTCAAAGGGTACAGAGAAAGCACTTTCAAAACTTCACGAGTATTTCCCTGAAATGCAGATTCTAGCCGTTAGTGGTAACTATTGTACTGACAAGAAACCTGCTGCTATAAATTGGATAGAGGGAAGAGGAAAATCTGTTGTTTGTGAAGCTGTCATTCCAGCCAAGGTTGTCAGAGAAGTATTAAAGACTACCACAGAGGCTATGATTGAGGTCAACATTAACAAGAATTTAGTGGGCTCTGCCATGGCTGGGAGCATAGGAGGCTACAACGCCCATGCAGCAAACATTGTCACCGCCATCTACATTGCCTGTGGACAGGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Robin A Lu et al.
Frontiers in pharmacology, 11, 469-469 (2020-05-22)
Despite maximal use of currently available therapies, a significant number of asthma patients continue to experience severe, and sometimes life-threatening bronchoconstriction. To fill this therapeutic gap, we examined a potential role for the 3-hydroxy-3-methylglutaryl-coenzyme A reductase (HMGCR) inhibitor, pitavastatin. Using
Chang-Sook Hong et al.
Journal of extracellular vesicles, 9(1), 1800979-1800979 (2020-09-19)
Most patients with acute myeloid leukaemia (AML) experience disease recurrence after chemotherapy largely due to the development of drug resistance. Small extracellular vesicles (sEVs) are known to play a significant role in leukaemia drug resistance by delivery of anti-apoptotic proteins
Olöf Bjarnadottir et al.
Scientific reports, 10(1), 558-558 (2020-01-19)
Statins, commonly used to treat hypercholesterolemia, have also been proposed as anti-cancer agents. The identification of a predictive marker is essential. The 3-hydroxy-3-methylglutaryl-coenzyme-A reductase (HMGCR), which is inhibited by statins, might serve as such a marker. Thorough antibody validation was
Jiajun Huang et al.
EBioMedicine, 45, 251-260 (2019-06-16)
Statin-associated muscle symptoms (SAMS) are the major adverse effects of the class of widely used lipid-lowering agents, and the underlying mechanism remains elusive. In this study, we investigated the potential contribution and molecular mechanism of increased lactate production to SAMS

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service