Skip to Content
Merck
All Photos(1)

Documents

EHU077571

Sigma-Aldrich

MISSION® esiRNA

targeting human BSG

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTGGTCACCATCATCTTCATCTACGAGAAGCGCCGGAAGCCCGAGGACGTCCTGGATGATGACGACGCCGGCTCTGCACCCCTGAAGAGCAGCGGGCAGCACCAGAATGACAAAGGCAAGAACGTCCGCCAGAGGAACTCTTCCTGAGGCAGGTGGCCCGAGGACGCTCCCTGCTCCACGTCTGCGCCGCCGCCGGAGTCCACTCCCAGTGCTTGCAAGATTCCAAGTTCTCACCTCTTAAAGAAAACCCACCCCGTAGATTCCCATCATACACTTCCTTCTTTTTTAAAAAAGTTGGGTTTTCTCCATTCAGGATTCTGTTCCTTAGGTTTTTTTCCTTCTGAAGTGTTTCACGAGAGCCCGGGAGCTGCTGCCCTGCGGCCCCGTCTGTGGCTTTCAGCCTCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... BSG(682) , BSG(682)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Tomoki Yoshioka et al.
The American journal of pathology, 189(7), 1338-1350 (2019-04-25)
Podocytes, which are susceptible to injury by various stimuli and stress, are critical regulators of proteinuric kidney diseases, regardless of the primary disease and pathogenesis. We further confirmed a significant correlation between urinary CD147/basigin (Bsg) levels and proteinuria in patients
Yao Meng et al.
Frontiers in cell and developmental biology, 8, 543856-543856 (2020-11-17)
Cancer stem cells (CSCs), responsible for cancer metastasis and recurrence, are generated from non-CSCs after chemo-radiation therapy. This study investigated the induction of CSC potential in non-stem breast cancer cells and the underlying molecular mechanisms in detachment culture. Bulk breast
Chaoqun Wang et al.
The American journal of pathology, 188(7), 1597-1607 (2018-04-10)
Epithelial-to-mesenchymal transition (EMT) is postulated to be a prerequisite for the establishment of endometriosis (EMS), a common reproductive disorder in women. Our previous studies have demonstrated the elevated expression of transmembrane glycoprotein CD147 and its prosurvival effect on abnormal cells
Junchen Chen et al.
PloS one, 12(8), e0183689-e0183689 (2017-08-24)
Melanoma accounts for nearly 80% of all deaths associated with skin cancer.CD147 plays a very important role in melanoma progression and the expression level may correlate with tumor malignancy. RING1 can bind DNA and act as a transcriptional repressor, play
Qi-Ming Wang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 39(6), 2308-2319 (2016-11-11)
It is well documented that overexpression of EMMPRIN (extracellular matrix metalloproteinase inducer) and MMPs (matrix metalloproteinases) by monocytes/macrophages plays an important role in atherosclerotic plaque rupture. Green tea polyphenol epigallocatechin-3-gallate (EGCG) has a variety of pharmacological properties and exerts cardiovascular

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service