Skip to Content
Merck
All Photos(1)

Key Documents

EHU061011

Sigma-Aldrich

MISSION® esiRNA

targeting human TRPC4

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGCCCTTAATCCACGAGAATCATGGGACATGTGGCATCCCACTCTGGTGGCAGAGGCTTTATTTGCTATTGCAAACATCTTCAGTTCTCTGCGTCTGATCTCACTGTTTACTGCAAATTCTCACCTGGGACCTCTGCAAATATCTCTGGGAAGAATGCTCCTGGACATTTTGAAGTTTCTATTCATATACTGCCTTGTGTTGCTAGCATTTGCAAATGGCCTAAATCAATTGTACTTCTATTATGAAGAAACGAAAGGGTTAACCTGCAAAGGCATAAGATGTGAAAAGCAGAATAATGCATTTTCAACGTTATTTGAGACACTGCAGTCCCTGTTTTGGTCAATATTTGGGCTCATCAATTTATATGTGACCAATGTCAAAGCACAGCATGAATTTACTGAGTTTGTTGGTGCCACC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Wei-Chun Wei et al.
The Journal of physiology, 595(16), 5525-5544 (2017-06-20)
The proton sensing ovarian cancer G protein coupled receptor 1 (OGR1, aka GPR68) promotes expression of the canonical transient receptor potential channel subunit TRPC4 in normal and transformed cerebellar granule precursor (DAOY) cells. OGR1 and TRPC4 are prominently expressed in
Corena V Grant et al.
Breast cancer research and treatment, 177(2), 345-355 (2019-06-24)
Triple-negative breast cancers (TNBCs) represent a heterogeneous group of tumors. The lack of targeted therapies combined with the inherently aggressive nature of TNBCs results in a higher relapse rate and poorer overall survival. We evaluated the heterogeneity of TNBC cell

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service