Skip to Content
Merck
All Photos(1)

Key Documents

EHU060831

Sigma-Aldrich

MISSION® esiRNA

targeting human TRAF5

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
¥38,100
50 μG
¥68,300

¥38,100


Estimated to ship onMarch 25, 2025



Select a Size

Change View
20 μG
¥38,100
50 μG
¥68,300

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

¥38,100


Estimated to ship onMarch 25, 2025


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCGTCAAGCCTCTGACAACTATTGAATTTGTAAGCTGCTATGCAAATGGGCATTTATATAAACTTGTGATGTTTCTTGTCAGAATTCTGAGTACTCTGTGAAGAACAGAAATGATCATATTCTTATGCATCTATCTGTATGGGTCTGAAGGTGTATATACAAACTGAGATGAGTCCTTATGACTCTTGATAAGCCTGAGTTTAACAACAACAAAAATGCCAAGTTGTCCTGAGCCCTTCTGCGTTGTTATGCCACTTCCCTACTGCTCATATGCACGCTGGCTCCCCTGGGCACGCAAGGATGAGTATGGGCCATGGGCCCCTGTAGAGCTGCTTACCTGGTGATGACCATGCACCTTACAATTTCTGAACAGTTAACCCTATAGAAGCATGCTTTATATGAGTGTCTTCTGGGAAGAGGAACCTTCTTAATCTCTTCTGTGGGATTTTCAAAATGCTAAAGACTCACACTGCAGCAATCATCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Florian Willecke et al.
Journal of vascular research, 56(6), 308-319 (2019-08-23)
Tumor necrosis factor (TNF) receptor-associated factors (TRAFs) are cytoplasmic adaptor proteins of the TNF/interleukin (IL)-1/Toll-like receptor superfamily. Ligands of this family such as TNFα, CD40L, and IL-1β promote chronic inflammatory processes such as atherosclerosis and restenosis, the latter being a
Jun Shen et al.
International journal of medical sciences, 10(2), 156-163 (2013-01-19)
TRAF3 and TRAF5 share a common ancestral gene, and interact as essential components of signaling pathways in immunity. TRAF3 and TRAF5 are overexpressed in the colon of rat/mouse models with colitis. However, the expressions of TRAF3 and TRAF5 in patients

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service