Skip to Content
Merck
All Photos(1)

Key Documents

EHU055151

Sigma-Aldrich

MISSION® esiRNA

targeting human INO80D

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGAAGAGAGCGGAGAGGAACCAGAGGACTCAGAGCAGGCCTCGCCCTACCAGGTTGCATGGTCCATCCGGGAAACCCTCAGATATCAAAGACATGCGTCAGATGATGATGATGCGGAGAGTAGGAGCTCCAGGGTGACTCAACTTTGCACTTACTTTCAGCAGAAATATAAGCACCTCTGCCGCCTGGAGCGGGCAGAATCTCGTCAAAAGAAATGCCGGCATACGTTTAGGAAAGCTTTGCTGCAGGCGGCCAGTAAAGAACCAGAATGCACTGGTCAGTTAATACAAGAACTGCGGAGAGCTGCATGCAGTCGAACCAGCATAAGCCGGACCAAGCTGAGGGAGGTGGAACCAGCAGCATGCAGTGGAACCGTGAAGGGTGAACAGTGCGCTAACAA

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Chun-Chi Chang et al.
International journal of oncology, 53(1), 417-433 (2018-05-12)
Long non‑coding RNAs (lncRNAs) have various functions, including chromatin remodeling and the regulation of gene expression at the transcriptional and post-transcriptional levels. However, few lncRNAs have been investigated comprehensively, with the majority being uncharacterized. In the present study, a bioinformatics
Gabriel G Malouf et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(15), 4129-4140 (2014-06-06)
MITF/TFE translocation renal cell carcinoma (TRCC) is a rare subtype of kidney cancer. Its incidence and the genome-wide characterization of its genetic origin have not been fully elucidated. We performed RNA and exome sequencing on an exploratory set of TRCC

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service