Skip to Content
Merck
All Photos(1)

Key Documents

Safety Information

EHU037851

Sigma-Aldrich

MISSION® esiRNA

targeting human EPCAM

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAGGGTCTAAAAGCTGGTGTTATTGCTGTTATTGTGGTTGTGGTGATAGCAGTTGTTGCTGGAATTGTTGTGCTGGTTATTTCCAGAAAGAAGAGAATGGCAAAGTATGAGAAGGCTGAGATAAAGGAGATGGGTGAGATGCATAGGGAACTCAATGCATAACTATATAATTTGAAGATTATAGAAGAAGGGAAATAGCAAATGGACACAAATTACAAATGTGTGTGCGTGGGACGAAGACATCTTTGAAGGTCATGAGTTTGTTAGTTTAACATCATATATTTGTAATAGTGAAACCTGTACTCAAAATATAAGCAGCTTGAAACTGGCTTTACCAATCTTGAAATTTGACCACAAGTGTCTTATATATGCAGATCTAATGTAAAATCCAGAACTTGGACTCCATCG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Regulatory Listings

Regulatory Listings are mainly provided for chemical products. Only limited information can be provided here for non-chemical products. No entry means none of the components are listed. It is the user’s obligation to ensure the safe and legal use of the product.

JAN Code

EHU037851-20UG:
EHU037851-50UG:


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yan Li et al.
BMC cancer, 16, 228-228 (2016-03-18)
The low survival rate of hepatocellular carcinoma (HCC) is partly attributable to its resistance to existing chemotherapeutic agents. Until now, there have been limited chemotherapeutic agents for liver cancer. Epithelial cell adhesion molecule (EpCAM) has been found to be over-expressed
Jacqueline Banyard et al.
BMC cancer, 14, 387-387 (2014-06-03)
Understanding the complex, multistep process of metastasis remains a major challenge in cancer research. Metastasis models can reveal insights in tumor development and progression and provide tools to test new intervention strategies. To develop a new cancer metastasis model, we

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service