Skip to Content
Merck
All Photos(2)

Documents

Safety Information

EHU031251

Sigma-Aldrich

MISSION® esiRNA

targeting human CAV1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGCTGAGCGAGAAGCAAGTGTACGACGCGCACACCAAGGAGATCGACCTGGTCAACCGCGACCCTAAACACCTCAACGATGACGTGGTCAAGATTGACTTTGAAGATGTGATTGCAGAACCAGAAGGGACACACAGTTTTGACGGCATTTGGAAGGCCAGCTTCACCACCTTCACTGTGACGAAATACTGGTTTTACCGCTTGCTGTCTGCCCTCTTTGGCATCCCGATGGCACTCATCTGGGGCATTTACTTCGCCATTCTCTCTTTCCTGCACATCTGGGCAGTTGTACCATGCATTAAGAGCTTCCTGATTGAGATTCAGTGCATCAGCCGTGTCTATTCCATCTACGTCCACACCGTCTGTGACCCACTCTTTGAAGCTGTTGGGAAAATATTCAGCAATGTCCGCATC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Regulatory Listings

Regulatory Listings are mainly provided for chemical products. Only limited information can be provided here for non-chemical products. No entry means none of the components are listed. It is the user’s obligation to ensure the safe and legal use of the product.

JAN Code

EHU031251-20UG:
EHU031251-50UG:


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Sang Woong Park et al.
Pflugers Archiv : European journal of physiology, 469(5-6), 829-842 (2017-03-18)
Activation of L-type voltage-dependent Ca
Natalia I Díaz-Valdivia et al.
Oncotarget, 8(67), 111943-111965 (2018-01-18)
Expression of the scaffolding protein Caveolin-1 (CAV1) enhances migration and invasion of metastatic cancer cells. Yet, CAV1 also functions as a tumor suppressor in early stages of cancer, where expression is suppressed by epigenetic mechanisms. Thus, we sought to identify
Morgan A Urello et al.
Acta biomaterialia, 62, 167-178 (2017-09-04)
Gene therapies have great potential in regenerative medicine; however, clinical translation has been inhibited by low stability and limited transfection efficiencies. Herein, we incorporate collagen-mimetic peptide (CMP)-linked polyplexes in collagen scaffolds to increase DNA stability by up to 400% and
Byung-Kyu Ryu et al.
BMC cancer, 17(1), 766-766 (2017-11-17)
Expression of caveolin-1 (Cav-1) is frequently altered in many human cancers and both tumor suppression and promotion functions of Cav-1 have been suggested based on its expression status. However, it remains unanswered how Cav-1 provokes opposite effects in different cancers
Akiko Okuda et al.
Biomacromolecules, 20(5), 1849-1859 (2019-03-21)
To facilitate the cytosolic delivery of larger molecules such as proteins, we developed a new cell-penetrating peptide sequence, named Pas2r12, consisting of a repeated Pas sequence (FFLIG-FFLIG) and d-dodeca-arginine (r12). This peptide significantly enhanced the cellular uptake and cytosolic release

Articles

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service