Skip to Content
Merck
All Photos(1)

Key Documents

Safety Information

EHU030001

Sigma-Aldrich

MISSION® esiRNA

targeting human DAB1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
¥38,100
50 μG
¥68,300

¥38,100


Estimated to ship onMay 31, 2025



Select a Size

Change View
20 μG
¥38,100
50 μG
¥68,300

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

¥38,100


Estimated to ship onMay 31, 2025


description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCGGGATTGATGAAGTTTCCGCAGCTCGGGGAGACAAGTTATGTCAAGATTCCATGATGAAACTCAAGGGCGTTGTTGCTGGCGCTCGTTCCAAAGGAGAACACAAACAGAAAATCTTTTTAACCATCTCCTTTGGAGGAATCAAAATCTTTGATGAGAAGACAGGGGCCCTTCAGCATCATCATGCTGTTCATGAAATATCCTACATTGCAAAGGACATTACAGATCACCGGGCCTTTGGATATGTTTGTGGGAAGGAAGGGAATCACAGATTTGTGGCCATAAAAACAGCCCAGGCGGCTGAACCTGTTATTCTGGACTTGAGAGATCTCTTTCAACTCATTTATGAATTGAAGCAAAGAGAAGAATTAGAAAAAAAGGCACAAAAGGATAAGCAGTGTGAACAAGCTGTGTACCAGACAATATTGGAAGAGGATGTTGAAGATCCTGTGTACCAGTACATTGTGTTTGAGGCTGGACAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Regulatory Listings

Regulatory Listings are mainly provided for chemical products. Only limited information can be provided here for non-chemical products. No entry means none of the components are listed. It is the user’s obligation to ensure the safe and legal use of the product.

JAN Code

EHU030001-20UG:
EHU030001-50UG:


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Bon-Hyeock Koo et al.
Experimental & molecular medicine, 51(6), 60-60 (2019-06-04)
Although arginase II (ArgII) is abundant in mitochondria, Ca2+-accumulating organelles, the relationship between ArgII activity and Ca2+ translocation into mitochondria and the regulation of cytosolic Ca2+ signaling are completely unknown. We investigated the effects of ArgII activity on mitochondrial Ca2+
Isabelle Tancioni et al.
Molecular cancer therapeutics, 13(8), 2050-2061 (2014-06-06)
Ovarian cancer ascites fluid contains matrix proteins that can impact tumor growth via integrin receptor binding. In human ovarian tumor tissue arrays, we find that activation of the cytoplasmic focal adhesion (FAK) tyrosine kinase parallels increased tumor stage, β5 integrin
Julia Lindqvist et al.
Molecular biology of the cell, 26(11), 1971-1984 (2015-04-09)
Contrary to cell cycle-associated cyclin-dependent kinases, CDK5 is best known for its regulation of signaling processes in differentiated cells and its destructive activation in Alzheimer's disease. Recently, CDK5 has been implicated in a number of different cancers, but how it

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service