Skip to Content
Merck
All Photos(1)

Key Documents

EHU027961

Sigma-Aldrich

MISSION® esiRNA

targeting human LRP6

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
¥38,100
50 μG
¥68,300

¥38,100

Estimated to ship onApril 07, 2025

All Photos(1)

Select a Size

Change View
20 μG
¥38,100
50 μG
¥68,300

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

¥38,100

Estimated to ship onApril 07, 2025

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCATGCACCTGGTTCTACTTCAAGATGAGCTATCATGTGGAGAACCTCCAACATGTTCTCCTCAGCAGTTTACTTGTTTCACGGGGGAAATTGACTGTATCCCTGTGGCTTGGCGGTGCGATGGGTTTACTGAATGTGAAGACCACAGTGATGAACTCAATTGTCCTGTATGCTCAGAGTCCCAGTTCCAGTGTGCCAGTGGGCAGTGTATTGATGGTGCCCTCCGATGCAATGGAGATGCAAACTGCCAGGACAAATCAGATGAGAAGAACTGTGAAGTGCTTTGTTTAATTGATCAGTTCCGCTGTGCCAATGGTCAGTGCATTGGAAAGCACAAGAAGTGTGATCATAATGTGGATTGCAGTGACAAGTCAGATGAACTGGATTGTTATCCGACTGAAGAACCAGCACCACAG

Ensembl | human accession no.

ENSG00000070018

NCBI accession no.

NM_002336

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... LRP6(4040) , LRP6(4040)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number
QCS
WXS
IRS
BCS

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Search for a COA

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xu Luo et al.
Neuroscience bulletin, 36(10), 1171-1181 (2020-06-21)
Neuronal apoptosis is one of the essential mechanisms of early brain injury after subarachnoid hemorrhage (SAH). Recently, HLY78 has been shown to inhibit apoptosis in tumor cells and embryonic cells caused by carbon ion radiation through activation of the Wnt/β-catenin
Yaqi Qiu et al.
Cell and tissue research, 383(3), 1077-1092 (2020-11-28)
Bile salt-dependent lipase (BSDL) within intestinal lumen can be endocytosed by enterocytes and support the intestinal barrier function. However, the epithelial-supporting effect of this protein has not been verified in a human cell line and neither the direct signaling pathway
Xu Luo et al.
Brain research bulletin, 162, 107-114 (2020-06-23)
Wnt/β-catenin signaling plays an essential role in blood-brain barrier (BBB) formation and maintenance under pathophysiological conditions. HLY78, a lycorine derivative, has been identified as a novel activator of Wnt/β-catenin signaling in vitro. However, the effects of HLY78 on the BBB
Antonia Franziska Eckert et al.
eLife, 9 (2020-05-23)
Development and homeostasis of multicellular organisms is largely controlled by complex cell-cell signaling networks that rely on specific binding of secreted ligands to cell surface receptors. The Wnt signaling network, as an example, involves multiple ligands and receptors to elicit
Jiaqi Xu et al.
Oncology letters, 14(5), 5638-5642 (2017-11-04)
The third member of the Dickkopf family (DKK-3), also known as reduced expression in immortalized cells (REIC), is a tumor suppressor present in a variety of tumor cells. Regarding the regulation of the Wnt/β-catenin signaling pathway, exogenous DKK-1 and DKK-2
View All Related Papers

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service