Skip to Content
Merck
All Photos(1)

Documents

EHU027341

Sigma-Aldrich

MISSION® esiRNA

targeting human DDB1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCACCGTCACTCTCAAGGATCTCCGTGTAGAACTCCTTGGAGAGACCTCTATTGCTGAGTGCTTGACATACCTTGATAATGGTGTTGTGTTTGTCGGGTCTCGCCTGGGTGACTCCCAGCTTGTGAAGCTCAACGTTGACAGTAATGAACAAGGCTCCTATGTAGTGGCCATGGAAACCTTTACCAACTTAGGACCCATTGTCGATATGTGCGTGGTGGACCTGGAGAGGCAGGGGCAGGGGCAGCTGGTCACTTGCTCTGGGGCTTTCAAGGAAGGTTCTTTGCGGATCATCCGGAATGGAATTGGAATCCACGAGCATGCCAGCATTGACTTACCAGGCATCAAAGGATTATGGCCACTGCGGTCTGACCCTAATCGTGAGACTGATGACACTTTGGTGCTCTCTTTTGTGGGCCAGACAAGAGTTCTCATGTTAAATGGAGAGGAGGTAGAAGAAACCGAACTGATGGGTTTCGTGGATGATC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hiroaki Kawara et al.
Biochemical and biophysical research communications, 519(1), 204-210 (2019-09-09)
The ERCC1-XPF heterodimer is a structure-specific endonuclease and plays multiple roles in various DNA repair pathways including nucleotide excision repair and also telomere maintenance. The dimer formation, which is mediated by their C-terminal helix-hairpin-helix regions, is essential for their endonuclease
Huiming Lu et al.
Nature communications, 8(1), 2039-2039 (2017-12-13)
Pathway choice within DNA double-strand break (DSB) repair is a tightly regulated process to maintain genome integrity. RECQL4, deficient in Rothmund-Thomson Syndrome, promotes the two major DSB repair pathways, non-homologous end joining (NHEJ) and homologous recombination (HR). Here we report
Qiuling Li et al.
The Journal of biological chemistry, 290(35), 21553-21567 (2015-07-15)
Pygopus 2 (Pygo2/PYGO2) is an evolutionarily conserved coactivator and chromatin effector in the Wnt/β-catenin signaling pathway that regulates cell growth and differentiation in various normal and malignant tissues. Although PYGO2 is highly overexpressed in a number of human cancers, the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service