Skip to Content
Merck
All Photos(1)

Key Documents

EHU024211

Sigma-Aldrich

MISSION® esiRNA

targeting human XDH

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATTTCCGCTGATGATGTTCCTGGGAGTAACATAACTGGAATTTGTAATGATGAGACAGTCTTTGCGAAGGATAAGGTTACTTGTGTTGGGCATATCATTGGTGCTGTGGTTGCTGACACCCCGGAACACACACAGAGAGCTGCCCAAGGGGTGAAAATCACCTATGAAGAACTACCAGCCATTATCACAATTGAGGATGCTATAAAGAACAACTCCTTTTATGGACCTGAGCTGAAGATCGAGAAAGGGGACCTAAAGAAGGGGTTTTCCGAAGCAGATAATGTTGTGTCAGGGGAGATATACATCGGTGGCCAAGAGCACTTCTACCTGGAGACTCACTGCACCATTGCTGTTCCAAAAGGCGAGGCAGGGGAGATGGAGCTCTTTGTGTCTACACAGAACACCATGAAGACCCAGAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

G-L Chen et al.
Oncogenesis, 6(9), e382-e382 (2017-09-26)
Xanthine dehydrogenase (XDH), a rate-limiting enzyme involved in purine metabolism, has an essential role in inflammatory cascades. Researchers have known for decades that XDH activity is decreased in some cancers, including hepatocellular carcinoma (HCC). However, the role of XDH in
You-Jin Kim et al.
International journal of molecular sciences, 21(20) (2020-10-15)
In the present study, we investigated the effects of xanthine oxidase (XO) inhibition on cholesterol-induced renal dysfunction in chronic kidney disease (CKD) mice, and in low-density lipoprotein (LDL)-treated human kidney proximal tubule epithelial (HK-2) cells. ApoE knockout (KO) mice underwent
Se-Hyun Oh et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(6), 7301-7314 (2019-03-13)
Hypercholesterolemia is reported to increase reactive oxygen species (ROS) and to promote breast cancer progression. ROS play an important role in tumor biology, and xanthine oxidase (XO) is an enzyme that generates ROS. The effects of febuxostat (FBX), an XO
Haixia Xu et al.
Free radical biology & medicine, 139, 70-79 (2019-05-20)
The natural compound Alternol was shown to induce profound oxidative stress and apoptotic cell death preferentially in cancer cells. In this study, a comprehensive investigation was conducted to understand the mechanism for Alternol-induced ROS accumulation responsible for apoptotic cell death.
Seon Min Woo et al.
Oncotarget, 8(63), 106672-106684 (2018-01-02)
Cathepsin G is a serine protease secreted from activated neutrophils, it has important roles in inflammation and immune response. Moreover, cathepsin G promotes tumor cell-cell adhesion and migration in cancer cells. In this study, we investigated whether inhibition of cathepsin

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service