Skip to Content
Merck
All Photos(1)

Documents

EHU007101

Sigma-Aldrich

MISSION® esiRNA

targeting human CD19

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGGTCCTGAGGATGAAGACTCCTTCTCCAACGCTGAGTCTTATGAGAACGAGGATGAAGAGCTGACCCAGCCGGTCGCCAGGACAATGGACTTCCTGAGCCCTCATGGGTCAGCCTGGGACCCCAGCCGGGAAGCAACCTCCCTGGGGTCCCAGTCCTATGAGGATATGAGAGGAATCCTGTATGCAGCCCCCCAGCTCCGCTCCATTCGGGGCCAGCCTGGACCCAATCATGAGGAAGATGCAGACTCTTATGAGAACATGGATAATCCCGATGGGCCAGACCCAGCCTGGGGAGGAGGGGGCCGCATGGGCACCTGGAGCACCAGGTGATCCTCAGGTGGCCAGCCTGGATCTCCTCAAGTCCCCAAGATTCACACCTGACTCTGAAATCTGAAGACCTCGAGCAGATGATGCCAACCTCTGGAGCAATGTT

Ensembl | human accession no.

ENSG00000177455

NCBI accession no.

NM_001770

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CD19(930) , CD19(930)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Sheng-Dan Nie et al.
Neurobiology of aging, 67, 171-180 (2018-04-21)
High glucose (HG)-induced mammalian target of rapamycin (mTOR) overactivation acts as a signaling hub for the formation of tau hyperphosphorylation, which contributes to the development of diabetes-associated cognitive deficit. How HG induces the sustained activation of mTOR in neurons is
Feng Yan et al.
Experimental neurology, 297, 92-100 (2017-08-02)
Neuronal apoptosis is a central pathological process in subarachnoid hemorrhage (SAH)-induced early brain injury. Previous studies indicated that ErbB4 (EGFR family member v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4) is essential for normal development and maintenance of the nervous
Areumnuri Kim et al.
Oncotarget, 6(35), 38225-38238 (2015-10-31)
Although proteasome inhibition with bortezomib (BTZ) is a validated treatment for relapsed or refractory mantle cell lymphoma (MCL), many patients show resistance to BTZ. However, the molecular mechanism of BTZ resistance in MCL has not been elucidated. In the present
Tai Kiuchi et al.
Science signaling, 7(339), ra78-ra78 (2014-08-21)
The epidermal growth factor receptor (EGFR) is a member of the ErbB family that can promote the migration and proliferation of breast cancer cells. Therapies that target EGFR can promote the dimerization of EGFR with other ErbB receptors, which is

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service