Skip to Content
Merck
All Photos(1)

Key Documents

EMU047431

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Lin28

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGAAGCGAAGATCCAAAGGAGACAGGTGCTACAACTGCGGTGGGCTAGACCATCATGCCAAGGAATGCAAGCTGCCACCCCAGCCCAAGAAGTGCCACTTTTGCCAAAGCATCAACCATATGGTGGCCTCGTGTCCACTGAAGGCCCAGCAGGGCCCCAGTTCTCAGGGAAAGCCTGCCTACTTCCGGGAGGAAGAGGAAGAGATCCACAGCCCTGCCCTGCTCCCAGAAGCCCAGAATTGAGGCCCAGGAGTCAGGGTTATTCTTTGGCTAATGGGGAGTTTAAGGAAAGAGGCATCAATCTGCAGAGTGGAGAAAGTGGGGGTAAGGGTGGGTTGCGTGGGTAGCTTGCACTGCCGTGTCTCAGGCCGGGGTTCCCAGTGTCACCCTGTCTTTCCTTGGAGGGAAGG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Wensen Ding et al.
International journal of clinical and experimental pathology, 13(5), 1136-1145 (2020-06-09)
As an evolutionarily conserved RNA-binding protein, LIN28 is known to be involved in the regulation of the translation and stability of a large number of mRNAs and the biogenesis of certain miRNAs. Increasing evidence indicates that LIN28 regulates many cellular
Qian Li et al.
Experimental cell research, 388(1), 111718-111718 (2019-12-25)
Successful implantation happens only when the development of a competent blastocyst synchronized with the differentiation of a receptive uterus. The exact mechanism affecting embryo implantation competency is still unclear. Previous data from our laboratory showed that several members of the
Jinzhuo Dou et al.
Molecular oncology, 14(9), 2288-2312 (2020-04-26)
LIN28A is a conserved RNA-binding protein that inhibits the biogenesis of let-7 microRNAs, thus promoting cancer progression. However, mechanisms underlying the activation of the LIN28A-let-7 signaling pathway remain poorly understood. Here, we show that LIN28A is SUMOylated in vivo and in vitro

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service