Skip to Content
Merck
All Photos(1)

Key Documents

EMU043721

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ephb4

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGCCATCAAGATGGGAAGATACGAGGAAAGTTTTGCAGCGGCTGGATTCGGCTCCTTTGAGGTGGTCAGTCAGATCTCTGCCGAGGACCTTCTCCGAATTGGAGTCACTCTGGCAGGACACCAGAAGAAAATCTTGGCCAGTGTGCAGCATATGAAGTCCCAAGCTAAGCCAGGAGCCCCTGGTGGGACAGGGGGACCAGCCCAGCAGTTCTGACCTCCAAGGACTCACCACCGTGGCAGATTCTTCTTTCCGGGAGGCAGAGTTGGGTGGGGACTCACAAGATGACCCCCTCCCCCTCGTCACAGCCTTCCCATTGGATTGCACTTTGAACAGAGGGGGTCGGAGACACAGGATTTGGGGAACCGTGCCATATGGGATCATACATGTGCCCTCCAGGCGGGGAACCCCAAACTCAGAGTGAGTCTTTCCCTCAAGACTGGGCAAAGAAACATCCCTACGTCTCTAACCTCCCATCTTCCCAGAGGGCTCTCTCCCCAAGCGCCTTCCACCTCAACGGGCATGTCCCTGCAGACCAAAGAGAAAGGGTGACCA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xiuqing Li et al.
PloS one, 9(8), e105326-e105326 (2014-08-26)
Effective treatment of transitional cell carcinoma (TCC) of the bladder requires early diagnosis. Identifying novel molecular markers in TCC would guide the development of diagnostic and therapeutic targets. Ephrins mediate signals via tyrosine kinase activity that modulates diverse physiologic and
Thao M Nguyen et al.
Stem cells (Dayton, Ohio), 33(9), 2838-2849 (2015-06-03)
The tyrosine kinase receptor, EphB4, mediates cross-talk between stromal and hematopoietic populations during bone remodeling, fracture repair and arthritis, through its interactions with the ligand, ephrin-B2. This study demonstrated that transgenic EphB4 mice (EphB4 Tg), over-expressing EphB4 under the control
Inga Mertens-Walker et al.
Experimental cell research, 333(1), 105-115 (2015-03-01)
The EphB4 receptor tyrosine kinase is over-expressed in a variety of different epithelial cancers including prostate where it has been shown to be involved in survival, migration and angiogenesis. We report here that EphB4 also resides in the nucleus of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service