Skip to Content
Merck
All Photos(1)

Key Documents

EMU026071

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Axl

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGGTACCGTGTCCGAAAGTCCTACAGCCGGCGGACCACTGAAGCCACCTTGAACAGTCTGGGCATCAGTGAAGAGCTGAAGGAGAAACTACGAGACGTCATGGTAGATCGGCATAAGGTGGCCTTGGGGAAGACCCTGGGAGAAGGAGAATTTGGCGCTGTGATGGAAGGTCAGCTCAATCAGGATGACTCCATCCTCAAGGTCGCTGTGAAGACCATGAAAATTGCCATCTGCACAAGATCAGAGCTGGAGGATTTCCTGAGTGAAGCTGTCTGCATGAAGGAATTTGACCACCCCAACGTCATGAGGCTCATTGGCGTCTGTTTTCAGGGCTCTGACAGAGAGGGTTTCCCAGAACCTGTGGTCATCTTGCCTTTCATGAAACACGGAGACCTACACAGTTTCCTCCTGTACTCCCGGCTCGGGGACCAGCCAGTGTTCCTGCCCACTCAGAT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Catherine Wilson et al.
Cancer research, 74(20), 5878-5890 (2014-08-16)
Molecularly targeted drug therapies have revolutionized cancer treatment; however, resistance remains a major limitation to their overall efficacy. Epithelial-to-mesenchymal transition (EMT) has been linked to acquired resistance to tyrosine kinase inhibitors (TKI), independent of mutational resistance mechanisms. AXL is a
Toni M Brand et al.
Cancer research, 74(18), 5152-5164 (2014-08-20)
The EGFR antibody cetuximab is used to treat numerous cancers, but intrinsic and acquired resistance to this agent is a common clinical outcome. In this study, we show that overexpression of the oncogenic receptor tyrosine kinase AXL is sufficient to
Rui Li et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(9), 7277-7283 (2015-04-22)
Increasing evidence has suggested that dysregulation of microRNAs (miRNAs) could contribute to tumor progression. The miR-34 family is directly transactivated by tumor suppressor p53 which is frequently mutated in various cancers; however, the effect of miR-34a on the ovarian cancer
Nam-Yi Kim et al.
International journal of oncology, 47(1), 353-360 (2015-05-16)
Metformin, the most frequently prescribed anti-diabetic drug, has recently been paid attention as a chemotherapeutic agent. In this study, we demonstrated that metformin decreased the viability of parental as well as cisplatin/taxol-resistant ovarian cancer cells. Its anti-proliferative effect was further

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service