Skip to Content
Merck
All Photos(1)

Documents

EHU125681

Sigma-Aldrich

MISSION® esiRNA

targeting human S100A4

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTCTTCCTGTCCTGCATCGCCATGATGTGTAACGAATTCTTTGAAGGCTTCCCAGATAAGCAGCCCAGGAAGAAATGAAAACTCCTCTGATGTGGTTGGGGGGTCTGCCAGCTGGGGCCCTCCCTGTCGCCAGTGGGCACTTTTTTTTTTCCACCCTGGCTCCTTCAGACACGTGCTTGATGCTGAGCAAGTTCAATAAA

Ensembl | human accession no.

ENSG00000196154

NCBI accession no.

NM_002961

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... S100A4(6275) , S100A4(6275)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Andy Chen et al.
Scientific reports, 7(1), 3459-3459 (2017-06-16)
To investigate phenotypic and genotypic alterations before and after bone metastasis, we conducted genome-wide mRNA profiling and DNA exon sequencing of two cell lines (TMD and BMD) derived from a mouse xenograft model. TMD cells were harvested from the mammary
Shasha Hou et al.
Laboratory investigation; a journal of technical methods and pathology, 98(8), 1025-1038 (2018-05-24)
As a member from S100 calcium-binding protein family, S100A4 is ubiquitous and elevated in tumor progression and metastasis, but its role in regulating obesity has not been well characterized. In this study, we showed that S100A4 was mainly expressed by
Giridhar Mudduluru et al.
Oncotarget, 8(13), 21081-21094 (2017-04-21)
The S100 calcium-binding protein A4 (S100A4) induces epithelial mesenchymal transition, migration, invasion, angiogenesis and metastasis. Its induced expression in several cancer types correlates with poor prognosis. Apart from the functional and transcriptional regulatory aspects of S100A4, its post-transcriptional regulation is
Ying Liu et al.
Cancer letters, 430, 1-10 (2018-05-08)
Our previous work has demonstrated that extracellular ATP is an important pro-invasive factor, and in this study, we tapped into a possible mechanism involved. We discovered that ATP could upregulate both the intracellular expression and secretion of S100A4 in breast
Xuelong Jiao et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 49(3), 1143-1162 (2018-09-10)
Anaplastic thyroid cancer (ATC), with 25% BRAFV600E mutation, is one of the most lethal human malignancies that currently has no effective therapy. Vemurafenib, a BRAFV600E inhibitor, has shown promise in clinical trials, including ATC patients, but is being hampered by
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service