Skip to Content
Merck
All Photos(1)

Key Documents

EHU120081

Sigma-Aldrich

MISSION® esiRNA

targeting human ORAI1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
€193.00
50 μG
€342.00

€193.00


Please contact Customer Service for Availability


Select a Size

Change View
20 μG
€193.00
50 μG
€342.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

€193.00


Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCGGCCTGATCTTTATCGTCTTCGCCGTCCACTTCTACCGCTCACTGGTTAGCCATAAGACTGACCGACAGTTCCAGGAGCTCAACGAGCTGGCGGAGTTTGCCCGCTTACAGGACCAGCTGGACCACAGAGGGGACCACCCCCTGACGCCCGGCAGCCACTATGCCTAGGCCCATGTGGTCTGGGCCCTTCCAGTGCTTTGGCCTTACGCCCTTCCCCTTGACCTTGTCCTGCCCCAGCCTCACGGACAGCCTGCGCAGGGGGCTGGGCTTCAGCAAGGGGCAGAGCATGGAGGGAAGAGGATTTTTATAAGAGAAATTTCTGCACTTTGAAACTGTCCTCTAAGAGAATAAGCATTTCCTGTTCTTCCAGCTCCAGGTCCACCTCCTGTTGGGAGGCGGTGGGGGGCCAAAGTGGGGCCACACACTCGCTGTGTCCCCTCTCCTCCCCTGTGCCAGTGCCACCTGGGTGCCTCCTCCTGTCCTGTCCGTCTCAACCTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ke Ma et al.
Journal of molecular medicine (Berlin, Germany), 97(10), 1465-1475 (2019-08-07)
Compromised renal phosphate elimination in chronic kidney disease (CKD) leads to hyperphosphatemia, which in turn triggers osteo-/chondrogenic signaling in vascular smooth muscle cells (VSMCs) and vascular calcification. Osteo-/chondrogenic transdifferentiation of VSMCs leads to upregulation of the transcription factors MSX2, CBFA1
Franz Ewendt et al.
Pflugers Archiv : European journal of physiology, 472(4), 503-511 (2020-03-20)
Bone cells secrete fibroblast growth factor 23 (FGF23), a hormone that inhibits the synthesis of active vitamin D (1,25(OH)2D3) and induces phosphate excretion in the kidney. In addition, it exerts paracrine effects on other cells including hepatocytes, cardiomyocytes, and immune
Shuang Liu et al.
Immunology and cell biology, 92(9), 752-760 (2014-06-18)
The regulated control of Ca(2+) influx is essential for the activation and function of the adaptive immune response, as Ca(2+) is a key regulator of important transcription factors. To determine whether Ca(2+) release-activated Ca(2+) (CRAC) channels contribute to the abnormal
Deng He et al.
International journal of molecular sciences, 16(7), 16313-16329 (2015-07-21)
The molecular events leading to nephrolithiasis are extremely complex. Previous studies demonstrated that calcium and transforming growth factor-β1 (TGF-β1) may participate in the pathogenesis of stone formation, but the explicit mechanism has not been defined. Using a self-created genetic hypercalciuric
Jingsheng Xia et al.
The Journal of physiology, 592(16), 3443-3461 (2014-05-27)
Store-operated calcium channels (SOCs) are calcium-selective cation channels that mediate calcium entry in many different cell types. Store-operated calcium entry (SOCE) is involved in various cellular functions. Increasing evidence suggests that impairment of SOCE is responsible for numerous disorders. A

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service