Skip to Content
Merck
All Photos(1)

Documents

EHU095951

Sigma-Aldrich

MISSION® esiRNA

targeting human PXN (1)

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGACAACAGGCCCTGAGAAGCTAAGCGATTTGCCCTGTGGCATGGATGGTAGAGAGGGGAGCTGGCACTTGAACTCAGGTCTGGCTCGACCTCAGAATGAGTGATCTTGTGTCTCTGTGCCCCAGGACTGCATCCTCTCACCAATACTTCACCAGCCTAGGGATCTGTGCTCCCAAGAGCCTGTTGACATTGTAAACCTGAATCCAATCCATAAACCAAAAGCCCAGGCTTAGAATCACATTGTGGTGGAGCGGGTGTTTGGTGGAGTCCCTGATTCAAAATGTTTGACAAGGAAGCCTGACC

Ensembl | human accession no.

ENSG00000089159

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PXN(5829) , PXN(5829)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Panfeng Fu et al.
Pulmonary circulation, 5(4), 619-630 (2015-12-24)
Paxillin is a multifunctional and multidomain focal adhesion adaptor protein. It serves as an important scaffolding protein at focal adhesions by recruiting and binding to structural and signaling molecules. Paxillin tyrosine phosphorylation at Y31 and Y118 is important for paxillin
Wen-Chung Tsai et al.
Journal of orthopaedic research : official publication of the Orthopaedic Research Society, 35(11), 2506-2512 (2017-02-25)
Platelet rich plasma (PRP) contains various cytokines and growth factors which may be beneficial to the healing process of injured muscle. The aim of this study was to investigate the effect and molecular mechanism of PRP on migration of skeletal
Tobias Pasqualon et al.
Oncotarget, 6(31), 31295-31312 (2015-09-18)
Syndecan-1 is a surface expressed heparan sulphate proteoglycan, which is upregulated by several tumor types and involved in tumor cell migration and metastasis. Syndecan-1 is shed from the cell surface and the remaining transmembrane fragment undergoes intramembrane proteolysis by γ-secretase.
Ludiane Gauthier et al.
Cancer research, 77(24), 7072-7082 (2017-10-13)
CD8
Jorge Eduardo Shortrede et al.
Molecular and cellular endocrinology, 430, 56-67 (2016-04-21)
Breast cancer is the major cause of cancer-related death in women. Its treatment is particularly difficult when metastasis occurs. The ability of cancer cells to move and invade the surrounding environment is the basis of local and distant metastasis. Cancer
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service