Skip to Content
Merck
All Photos(1)

Key Documents

EHU064811

Sigma-Aldrich

MISSION® esiRNA

targeting human LCK

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
€193.00
50 μG
€342.00

€193.00


Please contact Customer Service for Availability


Select a Size

Change View
20 μG
€193.00
50 μG
€342.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

€193.00


Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGTACCAGCCTCAGCCTTGAGAGGCCTTGAGAGGCCCTGGGGTTCTCCCCCTTTCTCTCCAGCCTGACTTGGGGAGATGGAGTTCTTGTGCCATAGTCACATGGCCTATGCACATATGGACTCTGCACATGAATCCCACCCACATGTGACACATATGCACCTTGTGTCTGTACACGTGTCCTGTAGTTGCGTGGACTCTGCACATGTCTTGTACATGTGTAGCCTGTGCATGTATGTCTTGGACACTGTACAAGGTACCCCTTTCTGGCTCTCCCATTTCCTGAGACCACAGAGAGAGGGGAGAAGCCTGGGATTGACAGAAGCTTCTGCCCACCTACTTTTCTTTCCTCAGATCATCCAGAAGTTCCTCAAGGGCCAGGACTTTATCTAATACCTCTGTGTGCTCCTCCTTGGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jeffrey J Kim et al.
Stem cells (Dayton, Ohio), 32(6), 1468-1479 (2014-02-13)
Molecular markers defining self-renewing pluripotent embryonic stem cells (ESCs) have been identified by relative comparisons between undifferentiated and differentiated cells. Most of analysis has been done under a specific differentiation condition that may present significantly different molecular changes over others.
S-Y Nam et al.
Clinical and experimental allergy : journal of the British Society for Allergy and Clinical Immunology, 48(7), 875-889 (2018-05-13)
Thymic stromal lymphopoietin (TSLP) is a regulator of mast cell-mediated allergic inflammatory reactions, but the manner in which TSLP contributes to allergic rhinitis (AR) remains unclear. Here, we sought to determine that TSLP plays a crucial role in AR by

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service